Why do some cases receive more investigative attention from investigators than others? is this right/appropriate?

Answers

Answer 1

It is true that some cases receive more investigative attention from investigators than others. This is because some cases are more important than others. Such cases include cases related to national security, public order maintenance, public safety, high-profile case, and cases affecting a large number of people. These cases require special attention from investigators are they are significant. Therefore, some cases receive more investigative attention from investigators than others. Yes, it is right/appropriate. This is because these cases are more significant and important and impact a large number of people. Some cases receive more investigative attention from investigators than others under the circumstances of national security, public safety, corruption, heinous crimes, robbery, terrorism, high profile case, etc.

Investigative abilities are the skills individuals use to gather statistics and generate conclusions to show crucial information. those talents also help professionals take a look at a subject closely and discover items of significance that may not have been certainly apparent to those who lack this skill.

Investigative journalism is a form of journalism in which journalists deeply look at an unmarried topic of interest, along with extreme crimes, political corruption, or corporate wrongdoing. An investigative journalist may additionally spend months or years gaining knowledge of and getting ready a document.

Learn more about investigative here: https://brainly.com/question/25578076

#SPJ4


Related Questions

A benefit of cohabitation is that Group of answer choices the partners won't have to deal with pressure to marry. the partners won't have to deal with pressure to have children. in the great majority of cases, it leads to marriage. it allows the partners to share housing costs and utility bills.

Answers

A benefit of cohabitation is that the partners won't have to deal with pressure to marry.

What is Cohabitation?By defining each partner's rights and obligations, a cohabitation agreement can make the process of divorcing considerably easier. By doing this, the likelihood of disagreements over money and other specifics can be decreased, and any conflicts can be resolved amicably without resorting to legal action.Living together before getting married has the advantage of allowing one to get to know each other better, enhancing the ability to solve problems together, strengthening the bond, and enhancing the relationship's resilience to stress, all of which can give some more confidence in the decision to get married.Their inertia argument states that cohabitation, as opposed to dating without cohabitation, improves the likelihood of marriage, in part because there are more incentives to stay together once a couple starts living together.

To learn more about Cohabitation refer to:

https://brainly.com/question/12882310

#SPJ4

If you suggest that smiling can make someone feel happier, then you are relying on the?

Answers

Answer:

smile to make them feel better

Explanation:

Wes Moore, an American author, and social entrepreneur, in his book The Other Wes Moore, shares his experience of growing up in the Baltimore streets during harsh times. He recounts his hardships, which ranged from gang-related violence to the lack of affluence where he grew up. At the same time, there was another man,

Answers

Prisoner Wes Moore, with the same name who lived a similar life to Author Wes Moore; however, he ended up with a different life.

What is the story The Other Wes Moore about?

In his book The Other Wes Moore, social entrepreneur and author Wes Moore from the United States describes his upbringing in the rough Baltimore streets. He describes his struggles, which included gang-related violence and growing up in a poor area. The same name-bearing person who lived a life identical to Author Wes Moore at the same time existed as Prisoner Wes Moore, who had a different outcome.

In the book "The Other Wes Moore," there are two Wes Moore, yet their lives are completely different from one another. While the other is serving a life sentence in a maximum security prison for the murder of Sergeant Prothero, the book follows the story of the author, who grew up to be very successful in his life and accomplished many things. Moore gives a fairly thorough description of the street culture. He depicts the lack of education, drug supply, and damaged homes. He discusses a variety of unsafe circumstances to demonstrate how dangerous the streets were with the assistance of the other Wes Moore.

Family, friends, and brotherhood. The two Wes Moore are not the only characters in the book; their families are also portrayed. Moore emphasizes how much our families influence who we are and how unlikely it is for most people to succeed without the assistance of their families. Wes Moore published a nonfiction book in 2010 titled The Other Wes Moore: One Name, Two Fates. It is written about two guys with the same name but totally different life stories, and it was published by Spiegel & Grau. The epilogue was written by Tavis Smiley. "The other Wes Moore is a drug dealer, a robber, and a killer," the author claimed.

Learn more about Wes Moore here:

https://brainly.com/question/5086398

#SPJ4

Creating friendship networks, establishing a social identity, developing a sense of belonging, meeting new people, and building connections with the community: the social capital support health benefits to be derived from skateboarding in skate-parks

Answers

Social capital support and a sense of connection with the region are recognized components of human well-being. This examination examines the social capital assist fitness blessings to be derived from skateboarding in skate-parks.

A content evaluation of 35 skateboarders’ survey responses discovered the existence of 4 blessings, namely, setting up new and reconnecting with antique friendships; bonding to a friendship group, gaining peer respect and status; and accelerated opportunities to have interaction with people.

Collectively, those benefits elevated the skateboarders’ social horizons by offering expanded opportunities to benefit network popularity and recognition. The consequences of planning integrated communities via enhancing skateboarding possibilities are mentioned.

Learn more about skateboarders here: https://brainly.com/question/10566022

#SPJ4

Which condition is associated with impaired immunity relating to the aging client?

Answers

Renal function decreases is a condition is associated with impaired immunity relating to the aging client.

What is meant by the decrease in the renal function of a person?

This is the term that has to do with the fact that the kidneys of a person are no longer working in the ways that it was supposed to work. One of the reasons for this could be due to the fact that the person is already aging. This would be seen in the forms of kidney diseases.

This could be a serious problem in humans and it could lead to the death of the person that is having this issue. Hence the Renal function decreases is a condition is associated with impaired immunity relating to the aging client.

Read more on the renal function here: https://brainly.com/question/15738627

#SPJ1

The southern most tip of the main land of India is_____

Answers

Answer:

south asisa

Explanation:

After Vanessa was placed in charge of a small group that was not working well, members of the group noticed that meetings began to run more smoothly and that goals were being met ahead of schedule. By helping the group fulfill procedural needs and task needs, Vanessa was showing

Answers

After Vanessa was placed in charge of a small group that was not working well, members of the group noticed that meetings began to run more smoothly and that goals were being met ahead of schedule. By helping the group fulfill procedural needs and task needs, Vanessa was showing good leadership.

Correct leaders pay attention to humans with incredible attention and sincerity. It facilitates them to understand humans and their views. active listening builds agree with and relationships ultimately. Right leaders talk with care, and awareness of the individual and the message; they do not interrupt and well know what is being stated.

Five Qualities of Effective Leaders

They are self-aware and prioritize personal development. They focus on developing others. They encourage strategic thinking, innovation, and action. They are ethical and civic-minded. They practice effective cross-cultural communication.

In addition to presenting route, idea, and steering, appropriate leaders showcase braveness, ardor, self-assurance, commitment, and ambition. They nurture the strengths and talents of their people and build teams dedicated to achieving common desires. The most effective leaders have the following traits in common.

Learn more about leadership here https://brainly.com/question/1232764

#SPJ4

N ______ swinging, two couples meet and exchange partners, and each pair goes off separately to a private place to have intercourse, returning to the meeting place at an agreed-upon time.

Answers

N inclosed swinging, two couples meet and exchange partners, and each pair goes off separately to a private place to have intercourse, returning to the meeting place at an agreed-upon time.

This is further explained below.

What is a couple?

Generally, two individuals or entities of the same kind are taken into consideration together.

In conclusion, In the activity known as "inclosed swinging," four couples get together, introduce themselves to one another, and then split off to engage in sexual activity in secret before meeting back at the original location at the predetermined hour.

Read more about couples

https://brainly.com/question/15136478

#SPJ1

When an australian hunter gives away most of his meat to relatives without specifying what is expected in return, he is exemplifying:_________

Answers

When an Australian hunter gives away most of his meat to relatives without specifying what is expected in return, he is exemplifying: generalized reciprocity.

Generalized reciprocity is a phenomenon in which individuals treat other people as they have treated others in the past. In addition to behavioral outcomes, it remains unclear whether intentional information also manipulates generalized interaction behavior.

Generalized reciprocity is giving without expecting an immediate return. For example, if you are shopping with a friend and you buy him a cup of coffee, you might expect him to buy you a cup in return at some point in the future.

Generalized reciprocity refers to a mode of exchange for goods and/or services in which the giver and recipient do not maintain accurate books of value or determine the amount or duration of returns.

Learn more about reciprocity  here: https://brainly.com/question/673545

#SPJ4

Looking for evidence to back up the way you already feel about something is an example of?

Answers

Looking for evidence to back up the way you already feel about something is an example of Confirmation bias.

What is confirmation bias?

Confirmation bias is the tendency to search for favor, and recall information in a way that confirms or supports one's prior beliefs or values. It is a type of cognitive bias that involves favoring information that confirms previously existing beliefs or biases.

For example, if.a person holds a belief that left-handed people are more creative than right-handed people

Confirmation bias is a psychological term for the human tendency to only seek out information that supports one position or idea and this causes you to have a bias towards your original position because if you only seek out information that supports one idea, you will only find information that supports that idea.

It should be noted that falsification bias is the opposite of confirmation bias and this means you actively look for evidence that disproves your point of view rather than confirms it.

Learn more about bias on:

https://brainly.com/question/4095022

#SPJ1

What action should you take if you become aware that sensitive compartmented information?.

Answers

You should make an effort to keep track of the path that was taken and any other pertinent information, and then promptly get in touch with the point of contact for your security.

This is further explained below.

What is sensitive compartmented information?

Generally, Information that is classified as Sensitive Compartmented Information (SCI) pertains to specific intelligence sources and methods. This category of data may also include details about sensitive collection systems, analytical processing, and targeting, as well as information that is derived from such data.

In conclusion, You should make an effort to keep track of the path that was taken as well as any other information that could be of value, and then promptly report it to the point of contact you have for security.

Read more about sensitive compartmented information

https://brainly.com/question/25948574

#SPJ1

Using the lense of freuds view of psychoanalysis, jesse wants to know why he is so unmotivated to do work lately. what should he consider?

Answers

Freud's Theory of Motivation suggests the following: that subconscious psychological factors, such as unspoken wishes and motivations, influence how people behave, including their purchasing habits.

Sigmund Freud, who was a physician in addition to developing this theory, is known as the father of psychoanalysis.



What is motivation?

Motivation is simply the reason and the inspiration for why we do OR not do the things that we chose to do or not do.

From the above, it maybe said that Jesse may be unmotivated to work because, the work is unaligned with his personal interests and what he hopes to attain personally.

Learn more about Freud Theory of Motivation at:
https://brainly.com/question/14737607
#SPJ1

Which of the following could lead to a positive externality on the international scale?

Foreign aid
Eminent domain
Social welfare
Unregulated manufacturing

Answers

One thing that can lead to a positive externality on the international scene is Foreign aid.

How can foreign aid lead to a positive externality?

A positive externality refers to when an action between parties leads to a good effect on other parties that were not part of the original transaction.

When foreign aid is given to other nations, those nations can invest the aid in their citizens which means that the citizens would then get a good effect thereby making the aid a positive externality.

In conclusion, a positive externality results from foreign aid.

Find out more on positive externality at https://brainly.com/question/477170

#SPJ1

Answer:

Foreign help

Explanation:

How can clearly defined and strictly enforced property rights increase economic growth in a dvc?

Answers

Strictly enforced property rights increase economic growth in a DVC are

Ensures workers receive rewards for their work;

Direct investment is encouraged by firms in IACs;

Investment risk is reduced.

How to improve DVC labor productivity? If capital accumulation increases production faster than growth, the margin of savings can generate more capital accumulation. When private DVC savings are transferred to an IAC account, this is known as capital.

The four main determinants of economic growth are human resources, natural resources, capital formation, and technology, but the importance that researchers place on each determinant is always different.

There are three main factors driving economic growth. Accumulation of capital stock. Increased labor input, eg B. workers or working hours. Technological progress.

Learn more about economic growth here: https://brainly.com/question/1690575

#SPJ4

If the concentration of fluoride anion and aluminum cation was increased to 5 m, by how much would the measured ecell change?.

Answers

If the concentration of fluoride anion and aluminum cation was increased to 5 m, then the measured ecell would have a charge of 0.0550.

Fluoride (/ ˈflʊəraɪd, ˈflɔːr- /) [3] is an inorganic monatomic anion of fluorine of the chemical formula F-(also referred to as [F] -), the salt of which is usually white or colorless. Fluoride salts usually have a noticeable bitter taste and are odorless.

Its salts and minerals are important chemical reagents and industrial chemicals and are mainly used to produce hydrogen fluoride for fluorocarbons. Fluoride is classified as a weak base because it binds only partially in solution, but concentrated fluoride is corrosive and can attack the skin.

Fluoride is the simplest fluoride anion. Fluoride ions are similar in charge and size to hydroxide ions. Fluoride ions are found in some minerals on Earth, especially fluorite, but are naturally found in trace amounts in the aquatic environment.

Learn more about Fluoride anion concentration  here: https://brainly.com/question/10929330

#SPJ4

High school dropout rates in many large u.s. cities are at about ______ percent.

Answers

High school dropout rates in many large u.s. cities are at about 40 percent.

Dropping out means leaving high school, university, college, or any other group for practical reasons, necessities, incapability, or disillusionment with the system from which the individual in question leaves. Dropouts face extremely bleak economic and social prospects. As compared to high school graduates, they're less likely to find a job and earn a living salary, and much more likely to be poor and to suffer from a variety of adverse health results.

Male young people and teens are more alike than their female counterparts to have dropped out of excessive college. In 2016, 7 percent of males ages 16 to 24 were high school dropouts, in comparison with 5 percent of ladies.

learn more about the economy here https://brainly.com/question/1106682

#SPJ4

__________ is a value system that reflects the belief that all people should be treated identically.

Answers

Egalitarianism is a value system that reflects the belief that all people are equal and should be treated identically.

What Is Egalitarianism?

Egalitarian refers to a group of people, idealism, belief or the general idea that aspires and aims for equal status, wealth, treatment and equal rights for all people.

It is the faith and belief in mortal equality especially with respect to political, social and economic affairs.

In an egalitarian society, all are considered equal, regardless of gender, race, religion, or age. There is not a class system in an egalitarian society but relatively equal access to income and wealth. Some societies are more egalitarian than others, and some areas of egalitarianism are part of economies, politics, and laws.

Learn more about Egalitarian on:

brainly.com/question/1000915

#SPJ4

Recent data has revealed that approximately _____ percent of adult men and _____ percent of adult women in the United States smoke cigarettes.

Answers

Recent data has revealed that approximately (A) 19 percent of adult men and 15 percent of adult women in the United States smoke cigarettes.

Current Adult Cigarette Smoking in the United States:Cigarette smoking continues to be the largest cause of preventable disease, disability, and death in the United States, accounting for about 480,000 fatalities each year, or around one in every five deaths. 1In 2020, about 13 out of every 100 adults in the United States aged 18 and up (12.5 percent) smoked cigarettes. This translates to an estimated 30.8 million adult smokers in the United States. Over 16 million Americans suffer from a smoking-related ailment.According to recent research, around 19% of adult men and 15% of adult women in the United States smoke cigarettes.

Therefore, recent data has revealed that approximately (A) 19 percent of adult men and 15 percent of adult women in the United States smoke cigarettes.

Know more about the United States here:

https://brainly.com/question/25125137

#SPJ4

Complete question:

Recent data has revealed that approximately _____ percent of adult men and _____ percent of adult women in the United States smoke cigarettes.

(A) 19; 15

(B) 16; 10

(C) 36; 30

(D) 50; 55

A _______ is a person who contacts government officials on behalf of a cause or issue.

Answers

Answer: Professional lobbyists

Explanation:

Reasons for rapid constitutional change​

Answers

The reasons for rapid constitutional change may be as a result of one or all of the following

Economic growthDifference in ethnicityReligionIncrease in population

What is constitution changes?

Constitutional changes are those changes or alterations in the constitutional book of a nation made with the aim of improving it

So therefore, the reasons for rapid constitutional change may be as a result of economic growth, difference in ethnicity, religion or increase in population

Learn more about constitutional changes:

https://brainly.com/question/13882468

#SPJ1

Workers tend to know much more about their own tendencies than their resumes predict. this is an example of:_______

Answers

The fact that workers know more of their own tendencies than can be inferred from their resumes is an example of asymmetric information.

What is asymmetric information?

This refers to the fact that in any transaction, one party will always know more about the transaction than the other party.

This is why workers will know more about what they can and cannot do than the employer who hired them based on what was in the worker's resume.

Find out more on asymmetric information at https://brainly.com/question/15345064

#SPJ1

When a leader can "talk the talk" but do not "walk the talk" on values, it refers to which of these symptoms of the failure of ethical leadership?

Answers

When a leader can "talk the talk" but do not "walk the talk" on values, it refers to ethical muteness symptoms of the failure of ethical leadership.

When people see immoral activity taking place and decide not to speak out, this is called moral muteness. It can also happen when people speak in a way that hides their moral convictions and ideas.

When we say that someone "talks the talk but doesn't walk the talk," we are referring to their lack of behaviour that is consistent with what they claim to believe. For example, when it comes to recycling, this person "talks the talk but doesn't walk the talk." If applying moral standards to make judgments without addressing them is the phenomena known as moral muteness, it would appear that this may eventually result in a much worse scenario where moral standards are entirely disregarded.

To learn more about ethics , refer

https://brainly.com/question/13402919

#SPJ1

The following graph shows the market for widgets in a local hardware store.

a) identify whether the price of widgets from $8 - $7 is elastic, unit elastic, or inelastic. Explain.

b) what is the price of widgets that maximize the hardware store’s revenue? Explain.

c) The price of widgets is $9. if the hardware store wants to increase its revenue, how should it change the price? Explain.

d) using the midpoint formula, calculate the price elasticity of demand for widgets when price increases from $7 to $8. Identify the coefficient as elastic, unit elastic, or inelastic.

e) using the midpoint formula, calculate the price elasticity of demand for widgets when price decreases from $6 to $5. Identify the coefficient as elastic, unit elastic, or inelastic.

f) based on the scenario in part E, how does the decrease in price affect the hardware store’s revenue?

Answers

The fall in price leads to a rise in total revenue, which means demand is elastic

How to illustrate the information?

a. Price of widgets= $8

Total revenue= P*Q= 8*12= $96

Price= $7

Total revenue= 7*16= $112

A fall in price leads to rising in total revenue, which means demand is elastic.

b. Price=$7 maximizes the total revenue. Total revenue when price=$7, total revenue= Price* quantity= $7*12=$112.

c. When the price is equal to $9, the demand is elastic. So there should be a decrease in price in order to increase total revenue.

d. Price elasticity of demand= ((96-112)/(112+96)/2)) ÷((8-7)/(8+7)/2))

= -2.14

This is elastic demand.

e. When price=$6, Quantity=18

When Price=$5, Quantity= 20

Price elasticity of demand= ((20-18)/(20+18)/2)) ÷((5-6)/(5+6)/2))

= - 0.58

This is an inelastic demand.

f. Total revenue falls from $108 to $100 when the price falls from $6 to $5.

Learn more about demand on:

brainly.com/question/1245771

#SPJ1

Information such as grading policies, submission guidelines, and assignment due dates can be found in?

Answers

Information such as grading policies, submission guidelines, and assignment due dates can be found in an online syllabus.

In an online course syllabus, there is likely information on how to obtain technical support such as grading policies, submission guidelines, and assignment due dates. Teachers can organise many topics or skills in a system using online syllabus. Students will be able to comprehend the context in a way that works for them thanks to the online assessment tools. To make it simple for students to access and participate in learning pages, videos and external websites are embedded within the class pages.

Learn more about Online syllabus here https://brainly.com/question/17539287

#SPJ1

Which statement best describes Africa immediately after the end of WWII?

Answers

Answer:

pls send the statements

Affect displays are primarily displayed through (the) _____

Answers

Affect displays are primarily displayed through (the) face and voice.

Emotes are verbal and non-verbal expressions of feelings (feelings). These signs are due to facial expressions, gestures and body language, volume, and tone of voice, laughter, crying, etc. Affect displays can be altered or faked to make a person look like one when they are feeling another (e.g. laugh when sad).

Body gestures (aka kinesics) can be categorized into five main types. Emblems directly translate words and phrases. The illustrator accompanies and "explains" the verbal message in the truest sense of the word. Emotion displays convey emotional meaning. A regulator monitors, receives, or controls another person's speech.

Learn more about displays of effect here: https://brainly.com/question/14737768

#SPJ4

Two-year-old lupe dropped a block into her toy box. she then dropped a cup, a car, and a doll-some gently, and some with force. Lupe's modification of her dropping scheme is an example of ________.

Answers

Two-year-old Lupe dropped a block into her toy box. she then dropped a cup, a car, and a doll-some gently, and some with force. Lupe's modification of her dropping scheme is an example of the accommodation.

Anything provided for convenience or to meet a need: such as a: accommodation, meals and services, or travel space and related services - typically used in some tourist facilities on boats.

lodging is the correct spelling of the word meaning lodging. "accommodation" is incorrect. Don't use it in English. The easiest way to learn to spell "accommodation" is to learn "double c" and "double m".

Hotels, motels, and inns are examples of accommodation for travelers. 2. The ramp leading to the front door of the apartment is an example of accommodation for a wheelchair occupant.

Learn more about block  here: https://brainly.com/question/4435145

#SPJ1

The emperor renounced his title to divinity when:_________
A. Buddhism first entered japan.
B. Christianity first entered japan.
C. Japan began to modernize.
D. World war ii ended

Answers

The emperor renounced his title to divinity when, World war ii ended,

Westerners frequently misinterpret the Japanese idea of the Emperor's divinity. The Emperor and the majority of his subjects never believed that the Emperor was a God in the sense of a superhuman supreme deity.

In reality, the Emperor gave up nothing that he had ever had when he renounced his divinity on the USA's demands in the Imperial rescript of January 1, 1946, instead simply restating an older customary set of ideas about the Imperial dynasty.

The Emperor continued to assert his lineage to Amaterasu and the priestly position that came with it, but his ritual duties shifted from being National obligations to being personal Shinto devotions intended to uphold Japan's good fortune.

Hence, option D is correct,

To learn more about Divinity here

https://brainly.com/question/906320

#SPJ4

What determines the maximum speed of transitions that a plc counter can count?

Answers

Answer:

program scan time

Explanation:

Maximum speed of the transitions that a PLC counter can count can be determined by two factors; scan time of the processor and frequency. If the frequency of the input signal is higher than the scan time of processor, use high speed counter to avoid errors. If the Controller has N KHz frequency, then it can able to count N x 103 pulses per second.

quizlet

Despite various innovations since 1985, what aspect of bhangra continues to reflect traditional south asian cultural norms?

Answers

Various innovations since 1985, what aspect of bhangra continues to reflect traditional south Asian cultural norms is that the division of male and female teams during tournaments, which continues to reflect South Asian ideas of distinct gender roles.

The role of Bhangra is that, It assisted them in positively reaffirming their identity in a hostile and exclusive British culture. a two-headed mango wood drum used to create the beats of bhangra music.

Drums accompanied the corresponding dance for Punjabi women, Giddha, but handclaps were used instead.

Several dancers perform forceful kicks, leaps, and bends of the body in a typical performance, frequently with lifted, thrusting arms or shoulders, to the accompaniment of quick songs called boliyan and, most importantly, to the beat of a dhol (double-headed drum).

The dhol adds a syncopated (accents on the weak beats), swinging rhythmic aspect to the song that has largely maintained the distinguishing feature of bhangra music. It is struck with a hefty beater on one end and a lighter stick on the other.

To learn more about Bhangra here

https://brainly.com/question/14300198

#SPJ4

Other Questions
If the age of the Earth is 4.6 billion years, what should be the ratio of Opb in a uranium-bearing rock as old as the Earth? 238U 206Pb 238U = 0.9997 x determine the degree of the maclaurin polynomial of 10 sin (x) necessary to guarantee the error in the estimate of 10 sin (0.13) is less than 0.001. to test whether a change in price will have any impact on sales, what would be the critical values? use 0.05. question content area bottom part 1 a. 2.7765 b. 3.4954 c. 3.1634 d. 2.5706 which of the following are true about a strengths-based approach to motivation? check all that apply. an engineer enables packet screening in order to prevent any malicious activity over hypertext transfer protocol (http) web based traffic. which technology should the engineer utilize? Write a 4 paragraph about the pro and cons of Pasadena?Answer ASAP PLS Consider the following DNA fragment from four different suspects in a crime: Suspect 1 - ACGTACGGTCCGACCTT Suspect 2 - ACCTACGGCGGCGGTCCGACCTT Suspect 3 - ACATACGGTCCGACCTT Suspect 4 - ACGTACGGCGGTCCGACCTT Select all of the true statement(s) about these suspects and their DNA. Check All That Apply This stretch of DNA contains one SNP. This stretch of DNA contains two SNPs. Suspect 2 has three copies of an SNP. Suspects 1 and 3 have the same number of copies of an STR. Suspect 2 has three copies of an STR. can i get help on this please i don't understand it so if someone can help i will give brainy Question 5. The graph represents the path of a rock thrown from the top of a cliff by a hiker:Determine what the key features of the curve represent in terms of the path of the rock. Some ways in which lack of energy supply affects societal development Use Newton's law of gravitation to determine the acceleration of an 85-kg astronaut on the International Space Station (ISS) when the ISS is at a height of 350 km above Earth's surface. The radius of the Earth is 6.37 x 10^6m. (GIVEN: MEarth = 5.98 x 10^24 kg The enthalpy of solution is defined as Hsolnv = Hsolute + Hsolvent + Hmix. Each of the terms on the right side of the equation are either endothermic or exothermic. Which answer properly depicts this. why do you think the allies did not respond to the genocide of jews in countries under nazi control? The highest and the lowest rate of diffusion, respectively of the following six gases at 25C ? O2 CH4 SO3 Cl2 CO2 A 503 & 02 B. CH4 & 503 C CO2 8 Xe D. CH4 & Xe E. CO2 & Cl2 : In Principles that guide process, it is stated that we should examine our approach to development and be ready to change it as required. Which of the 8 principles focuses on that fact? 1 & 2 1 & 3 1 & 3 & 8 none of the above Can you help with that please Explain how your results would be different if you had used a 300 line per millimeter grating compared to a 600 line per millimeter. If it is critical that you measure the wavelength precisely forgiven lamp which of the following grading would you use 800 lines per centimeter 400 lines per centimeter centimeter or a hundred lines per centimeter? The constant dividend growth model may be used to find the price of a stock in all of the following situations except:Question 14 options:when the expected dividend growth rate is less than the discount rate.when the expected dividend growth rate is negative.when the expected dividend growth rate is zero.when the expected dividend growth rate is more than the expected return.the constant growth model works in all known circumstances, it never fails. _____ refers to the absorption of minority groups into dominant culture, while _____ reflects when minority groups retain their distinct cultural identity. A rectangle has an area of 114cm squared and a perimeter of 50 cm. What are its dimensions under cumalative voting procedures, how many directors can the dissident stockholders elect with the proxies they now