Which trade organization regulates trade in North America

Answers

Answer 1
world trade organization
Answer 2

FAFSA,

Explanation:

NAFTA, North American Free Trade Agreement


Related Questions

How can I get the right answer on the quiz before school night ​

Answers

Answer: Answer is simple: Study but if this has to do with an actual question then show me a picture please.

Explanation:

I need help on this please

Answers

The answer is c because they had to pay their taxes
Answer is C. Hope this helped!

2. (34) How are the authors of the articles similar?
A Both worry that their views may be out of step with those of the majority.
B Both are interested in how changes to culture affect the human experience.
C Both express an intention to continue their research.
D Both believe it is important to examine trends in other cultures.

Answers

Answer:

im guessing c

How would you describe the speaker's attitude toward death in the "Do Not Go Gentle into That Good Night"?

Answers

Answer:

Speaker's attitude is complex, self contradictory

Explanation:

The poem 'Do Not Go Gentle into That Good Night' is a poem about death. Despite of death being ultimate inevitable end of each life. Still, speaker finds it (his father's prospective death) difficult to accept. He expresses 'rage, burn, rave' fierce & brave fight feelings against death.

Who is an example of a dynamic character in The Secret Garden?

Dickon Sowerby

Mrs. Lennox

Colin Craven

Martha Sowerby

Answers

Answer: Colin Craven

Explanation:

The Secret Garden is largely concerned with two dynamic characters who undergo incredible transformations through the power of love and nurturing. Mary and Colin represent profound change through connection.

Answer:

Colin Craven

Explanation:

I read the book

supporting details for the wounded wolf

Answers

Answer:

I got u slightly confused but if it is supporting the story then....

The story is about a fierce and bold wolf fighting for his life once he survives he shouts his victory to all.

The strong will for the wolf to not give up holds this story together.The pack holds each other up even though one wolf gets hurt.The wounded wolf fought hiself to victory with the help of his fellow pack.Once striked he gained new strength.They decided to play a game for the strength of all who took the predators down especially the wounded and the hurt wolf.

Explanation:

Plz rate my answer & if you have any questions feel free to ask:)

I’ll give brainliest!! Plz help!

Type your response in the box.
In this lesson, you will write a persuasive essay on a topic related to poetry. Pick one of these topics:
Does reading poetry make a difference in your education?
• What is the most important element in a good poem-rhyme, meter, or figurative language?
• Do poems need to be read aloud to be fully appreciated?
In your essay, you may use the poems you studied earlier in this course, which are listed below. You may also write
about other poems you have read and enjoyed.
"The Road Not Taken C" by Robert Frost
"Nothing Gold Can Stay e" by Robert Frost
"The Rose Tree by William Butler Yeats
"I'm Nobody! Who are you? C" by Emily Dickinson
"America 2" by Claude McKay
Sonnet 130 e by William Shakespeare
"Theme in Yellow e" by Carl Sandburg
Which topic did you choose? What is the argument or viewpoint that you will present in your essay?

Answers

Poetry is a great outlet for surging emotions. Teaching and learning poetry helps students respect and understand the views of people all around the world. Because we are in an age of increasing diversity, this is very important to education. The most important thing is, poetry can have a positive impact on students mental health. Poetry uses powerful imagery. Poems are the epitome of “show, don't tell.” In a poem, you don't have a lot of time or space to spend narrating or telling the reader what's happening.

Read the passage from “Part of the Stew.”

I was mighty proud of our work. . . . I held on to a great hope that it would keep my father and my city safe.

In this passage, the narrator engages readers by

describing the details of the setting.
quoting another character.
explaining another character’s actions.
revealing his own thoughts and feelings.

Answers

Answer:

The character was revealing his own thoughts and feelings. He and others have done something and he's hoping for the best.

The narrator manages to engage the readers by revealing their own thoughts and feelings, as shown in the last answer option.

What does this narration present?Presents the first-person point of view.Allows the narrator to express himself.It allows the reader to have sympathy and empathy for the narrator.

The narration with the first-person point of view, allows the narrator to express his thoughts and feelings creating a connection with the readers, who can identify emotions they have already felt, making them become involved with the story.

You can learn more about the first-person point of view at the link below:

https://brainly.com/question/13845140

FINISH THE LYRICS ~~~ I said my face bomb, butt tight Racks stack up Shaq height Jewelry on me, flashlight I been lit since last night Hit him with that good good Make a boy act right Broke boys don't deserve no kitty I know that's right.

Answers

Answer:

Big bag bussin' out the Bentley Bentayga

Man, Balenciaga Bardi back and all these ..............

(sorry )....

It's big bags bussin' out the Bentley Bentayga, man

Birkin bag, Bardi back and all

Mate after that it's not letting me write

enjoy your day

#Captainpower

Big bag bussin' out the Bentley Bentayga
Man, Balenciaga Bardi back, know how I give it up
It's big bags bussin' out the Bentley Bentayga, man
Birkin bag, Bardi back, know how I give it up

Spell R E D lol uh
spell it

Answers

Answer:

R e a d

Explanation:

Answer:

R E D

Explanation:

Explain the difference between pastiche and satire

Answers

Answer:

Satire, pastiche, homage, and parody – four literary terms subject to frequent misuse. Most readers and writers have some sense of what each word means, but many struggle to pin down the specifics – something about real-world references, humor, and mockery, right? Well, kind of. These four horsemen may describe similar genre conventions and devices, but don’t be fooled: they’re not synonymous.

Answer:

Satire is making fun of something and pastiche is simply imitating it.

30 POINTS!!!!


Item 4
Read this excerpt from Chapter 8 of Lord of the Flies, in which Simon first encounters the severed pig's head.

The pile of guts was a black blob of flies that buzzed like a saw. After a while these flies found Simon. Gorged, they alighted by his runnels of sweat and drank. They tickled under his nostrils and played leapfrog on his thighs. They were black and iridescent green and without number; and in front of Simon, the Lord of the Flies hung on his stick and grinned. At last Simon gave up and looked back; saw the white teeth and dim eyes, the blood—and his gaze was held by that ancient, inescapable recognition. In Simon’s right temple, a pulse began to beat on the brain.

What does author William Golding allude to by naming the pig's head the Lord of the Flies?

A. He references a Greek myth in which two men fly using wings made of wax and feathers.

B. He references the Bible's Old Testament, which uses that same name for the devil.

C. He references a 1958 film called The Fly in which a man is physically merged with a fly.

D. He references a Greek myth in which a being named Myiagros chases away flies.

Answers

He references the Bible's Old Testament, which uses that same name for the devil. Thus, option B is the correct option.

What does author William Golding allude to by naming the pig's head the Lord of the Flies?

Simon imagines that the pig's head on the stick is speaking to him as he is having an epileptic seizure. Here, Golding makes it obvious that the pig's head is a representation of the beast, which stands for evil and is also known as the Lord of the Flies, another name for the Devil. During his hallucination, Simon understands that the beast is not something that can be killed because it exists inside humans.

Simon observes the horde of flies encircling the head of the pig that the hunters have mounted on a pole. Simon loves to hide in the clearing where the pig's head is. The Lord of the Flies, an allusion to Beelzebub, is used for the first time to describe the pig's head in this passage.

Learn more about Lord of the Flies here:

https://brainly.com/question/3884795

#SPJ3

Isn’t this puppy so adorable?!

Answers

Answer:

Explanation:

I’m failing math

Answer:

I can confirm that puppy is absolutely adourable

As children learn to write, prekindergarten teachers should focus on?

Answers

Answer:

set of language and literacy skills focused primarily on the development and ... In this domain, young children learn that writing has a purpose and that print ... There are multiple strategies teachers can use to scaffold children's writing, ... “Preschool Teachers and Children's Emergent Writing: Supporting Diverse Learners.

Explanation:

how to write an email to teacher because im sick ( we have test this morning but im absent)

Answers

Dear [teacher],

This is [your first and last name] from your [___] period class. I just wanted to let you know that I haven't been feeling too well. For this reason, I will be absent from class tomorrow. I am aware of the fact that we have a test, but I will make up for it when I am feeling better. Thank you for understanding!

Sincerely,

[your first and last name]

what does obliterate means?​

Answers

Destroy utterly or wipe out

Answer:

destroy or demolish

Which line is an example of personification?
a. line 9
b. line 18
c. line 23
d. line 26

Answers

Answer:

line 18 because it shows that she does not care, and that she is a careless person (sorry if it is wrong)

Choose the word that means most important.
A.extreme
B.familiar
C.primary
D.serious

Answers

D. Serious
Bc when you are serious it usually means something important

There are 5 houses in five different colors.
In each house lives a person with a different nationality.
These five owners drink a certain type of beverage, smoke a certain brand of cigar and keep a certain pet.
No owners have the same pet, smoke the same brand of cigar or drink the same beverage.
The question is: Who owns the fish?

Answers

Answer:

Check TedEd

Explanation:

Ive seen this before on that channel, it goes super in depth on it

7. He fought like a tiger, writhing and twisting, half flinging them off, and starting toward his
unconscious enemy." (chapter 15)

8. "When Jurgis lifted up the mattress he discovered beneath it a layer of scurrying roaches,
almost as badly frightened as himself." (chapter 16)
I

9. “All day long this man would toil thus, his whole being centered upon the purpose of making
twenty-three instead of twenty-two and a half cents an hour; and then his product would be
reckoned up by the census-taker, and jubilant captains of industry would boast of it in their
banquet-halls, telling how our workers are nearly twice as efficient as those of any other coun-
try." (chapter 20)

10. "So spoke Elzbieta, naïvely, and the young lady laughed and was rather at a loss for an an-
swer-she stood and gazed about her, and thought of a cynical remark that had been made
to her, that she was standing upon the brink of the pit of hell and throwing in snowballs to
lower the temperature." (chapter 21)
LITERARY DEVICE FOR EACH OF THEM PLS

Answers

Answer:

Simile, Personification, Synecdoche and Metaphor

Explanation:

He fought like a Tiger

...scurrying roaches, almost as badly frightened as himself

...captains of industry

....pit of hell

Could someone please help me on this essay?
Writing Prompt.
Labeling foods and drinks with warnings may have benefits. You have been asked to write an informational essay for a health and environment-focused website explaining the benefits that may result from putting warning labels on certain types of foods and beverages. Your essay must be based on ideas and information that can be found in the “Labeling Foods and Drinks” passage set.

Topic:
informative

Answers

Answer:

Only with a clear label will consumers be able to make informed choices when they buy food. ... If there were warnings on the wrappers, like those on cigarette packets, children would be able to see how junk food can negatively impact their health, and that might help them make healthier snack choices.

Explanation:

I'm not sure that's the answer

Sore ga kotae ka wakaranai

それが答えかわからない

The  topic of the essay is people's eating and drinking habits and their effects, and the information provided shows how different foods affect different people, and based upon that, different research projects have been carried out.

What are the effects of food levels on people's health?

Labels are very important as they help inform people about the potential health risks associated with certain foods and drinks, such as sugary drinks and labels can help people understand the link between consuming large amounts of sugar and the increased risk of obesity and diabetes so that they can avoid consuming these foods.

Hence, the topic of the essay is people's eating and drinking habits and their effects, and the information provided shows how different foods affect different people, and based upon that, different research projects have been carried out.

Learn more about the food levels here.

https://brainly.com/question/12974435

#SPJ6

Reread the second section of the song. Using textual evidence to support your answer, what can you infer about the journey forward from the "dark past"?

Answers

Answer:

The dark past which was the period of slavery was marked with faith and hope that someday the blacks will be redeemed from their bondage. The second section begins thus, "Sing a song full of the faith that the dark past has taught us". This shows that during the dark past, what kept the slaves going was the faith that they had in their future redemption.

Explanation:

The song, Lift Every Voice by J. Rosamond Johnson and James Weldon Johnson, was a song of liberty by African Americans on their freedom from slavery. Known as the "Black National Anthem" in the United States, the song was composed to mark the anniversary of the birthday of former U.S President, Abraham Lincoln in 1905.

Lincoln fought for and officially realized the freedom of Blacks from slavery in the United States. The song reflects on their struggles in the past as slaves and the hope they had that they would someday, realize freedom.

THE OPTIONS ARE THE CAPITAL SENTENCES

Select the correct text in the passage.

Read this excerpt from a speech that British Prime Minister Winston Churchill made shortly after Japan bombed Pearl Harbor. Which part shows Winston Churchill’s feelings about the war

THIS IS A STRANGE CHRISTMAS EVE. Almost the whole world is locked in deadly struggle, and, with the most terrible weapons which science can devise, the nations advance upon each other. Ill would it be for us this Christmastide if we were not sure that NO GREED FOR THE LAND OR WEALTH OF ANY OTHER PEOPLE, NO VULGAR AMBITION, NO MORBID LUST FOR MATERIAL GAIN AT THE EXPENSE OF OTHERS, had led us to the field. Here, in the midst of war, RAGING AND ROARING OVER ALL THE LANDS AND SEAS, CREEPING NEARER TO OUR HEARTS AND HOMES, HERE, AMID ALL THE TUMULT, we have tonight the peace of the spirit in each cottage home and in every generous heart. Therefore we may cast aside for this night at least the cares and dangers which beset us, and MAKE FOR THE CHILDREN AN EVENING OF HAPPINESS IN A WORLD OF STORM.

Answers

Answer:

The two highlighted sentences in the middle

Answer:

I think it's  

Ill would it be for us this Christmastide if we were not sure that no greed for the land or wealth of any other people, no vulgar ambition, no morbid lust for material gain at the expense of others, had led us to the field.

Explanation:

Should students attend HBCU's (Historically Black College or University) or PWI's (Predominantly White Institution)

Answers

Explanation:

I agree that each student should make their choice depending on affordability and if credits can be transferred easily.

Some schools don't transfer credits causing the student the necessity to retake classes.

this is the name of the game...MONEY

Which quotation supporters the authors claim that riding a bus can be just as efficient as flying

Answers

Answer:

I believe you are right it is (A).

Explanation:

Answer:

I'm going to say it is D.

Explanation:

I hope this helps! If right may I please have brainliest? :)

Which of the following is one way that drama does not reveal the plot?

Answers

Answer:

Narration

Explanation:

20 points!
Which best summarizes the Missouri Compromise?
a
California was admitted as a free state and the North agreed to the Fugitive Slave Law.
b
The Republic of Texas was annexed into the United States.
c
Missouri would join the Union as a slave state and Maine would join the Union as a free state.
d
Maine would join the Union as a slave state and Missouri would join the Union as a free state.

Answers

Answer: A

Explanation:

who is the king of Janakpur​

Answers

Answer:

King Janaka.

Explanation:

King Janaka was the ruler of Mithilla, present day Janakpur, during the Treta Yuga. Although his real name was King Seeradhwaj Janaka, he is commonly known only as King Janaka. He was brave and also as well versed in Shastras and Vedas as any sage would be.

What meaning is connoted by the word
"chronic" in the text?
Mild
Generous
Reasonable
Consistent

Answers

Consistent I hope this helps

use the word debate in a sentence

Answers

Answer:

We had a large disagreement, but I told him I was too tired to debate with him again.

Alex, i don’t want to debate this issue.
Other Questions
If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks. hey can someone give me an idea how I should do a rough draft on a computer What is the range of the function y=-2/3x-10given a domain of{-9,-3,0,3,9} Read this sentence from paragraph 2 of "Puzzle Solved"Solving this thing is as easy asslaying Medusa!Why does Anya compare the cryptogram to slaying Medusa?A It is difficult to conquerOB. It is based on mythologyoc. It is not what it seems.OD. It is hard to look at. A 55 kg boy is riding a skateboard at a speed of 1.0 m/s. What is hiskinetic energy? A right rectangular prism has a length of 6 centimeters, a width of 7 centimeters, and a height of 5 centimeters. What is the volume of the prism? ____cm3a) 214b) 197c) 210CORRECT ANSWER= BRAINLY!! 60>x and x >57A x=61B x=59C x=50