when a competitive market is at equilibrium this is also when the total surplus is minimized equal maximized___

Answers

Answer 1

When the price is the same as the market equilibrium price, total surplus is maximised.

Why is total surplus maximised in an equilibrium market?

When a market provides at its equilibrium value and quantity, overall welfare is maximised. Due to the fact that no alternative quantity and price combination can produce a higher level of total surplus, this level of output is regarded as allocatively efficient. The economy is more efficient the bigger the overall surplus. At the quantity of the free market equilibrium, total surplus and hence economic efficiency are maximum. Only the most effective producers will indeed be capable of producing a product that is cheaper than the market rate in highly competitive markets.

To know more about total surplus visit:

https://brainly.com/question/29213834

#SPJ4


Related Questions

FILL IN THE BLANK Dollar Rental Car, Avis, and Hertz compete directly on similar attributes in the same target market, with ______ positioning.

Answers

Dollar Rental Car, Avis, and Hertz compete directly on the same attributes in the same target market, with "head-to-head" positioning.

Head-to-head positioning is a marketing strategy where companies compete directly with each other by emphasizing similar attributes and targeting the same market segment. In the case of Dollar Rental Car, Avis, and Hertz, they are all major players in the car rental industry, offering similar services and targeting similar customers.

To differentiate themselves, they may emphasize factors such as pricing, convenience, availability of certain types of vehicles, or loyalty programs. The goal is to convince customers that their brand offers the best overall value and to win a larger share of the market.

You can learn more about Head-to-head positioning at

https://brainly.com/question/26685298

#SPJ4

General purpose governments generally provide a wider range of services to their residents than do special purpose governments? T/F

Answers

The answer is True, General purpose governments generally provide a wider range of services to their residents than do special purpose governments is true.

An official government definition is what?

The structure used to run a state or a community is called a government. Government is described by the Columbia Encyclopedia as "a system of social management where the power to enact laws and to enforce them is vested in a certain group in society."

What is the purpose of the government?

A government is a structure whereby authorities use their authority to enact and uphold laws. The fundamental duties of a government include providing direction, upholding the law, delivering public services, ensuring national security, ensuring economic security, and assisting with the economy.

To know more about Government visit:

https://brainly.com/question/8561829

#SPJ4

all except which of the following help to develop informal networks that play an important role in an organization?

Answers

All except d) performance reviews help to develop informal networks that play an important role in an organization.

Informal networks play a significant role in the exchange of news and information within the organization between peers, superiors, and subordinates, and it's frequently the case that those with the inside track are the first to learn of impending announcements regarding promotions and the introduction of new products.

In addition to this, informal networks can be a good way to bond with coworkers and relieve stress in high-stress environment of today. Sharing coffee or tea during breaks and having light conversations, or "talking shop," as it is also known, can add value to the organization.

To learn more about informal network: https://brainly.com/question/28147648

#SPJ4

Note that the full question is:

All of the following help to develop informal networks that play an important role in an organization EXCEPT for:

a) Job rotation

b) Company softball team

c) Virtual communities

d) Performance reviews

e) Attendance at a conference

a firm with more courteous and helpful clerks than its rivals enables the firm to differentiate their good based on which of the following?

Answers

Service to a firm with more courteous and helpful clerks than its rivals enables the firm to differentiate its good base.

What is the role of customer service?

A Customer Service Representative assists customers who have complaints, orders, or questions about the organization's products/services. They also provide solutions that are tailored to the specific needs of the customer at every stage of the process.

This statement emphasizes the importance of providing good customer service and how it can contribute to a firm's success. By focusing on building a base of satisfied customers, a firm can create a competitive advantage that sets it apart from its rivals.

Learn more about customer service here:

https://brainly.com/question/13540066

#SPJ1

in a major announcement at an annual medical conference, dr. troy lutkes, research director of lucerne pharmaceuticals, informs the medical community of a breakthrough in the treatment of high blood pressure. As _____ for his organization, he answers questions posed to him by his medical research colleagues and members of the press. multiple choice :
A. disseminator B. spokesperson C. liaison figurehead D. disturbance E. handler

Answers

As spokesperson for his organization, he answers questions posed to him by his medical research colleagues and members of the press. Thus, option B is correct.

What is spokesperson?

The spokesperson for a company is in responsibility of effectively conveying important information that the general public needs to (or wants to) know.

A spokesperson can aid in a brand's recognition and credibility building. A poorly chosen representative, however, could be untrustworthy or cast a negative light on your company.

Dr. Troy Lutkes is acting as a prophet for his association by making a major advertisement about a advance in the treatment of high blood pressure and answering questions from the medical exploration community and press. As a prophet, he represents his association to the outside world and communicates important information on its behalf.

Learn more about spokesperson

https://brainly.com/question/28144930

#SPJ1

Table 8.2.2 lage of Popcom Marginal Bottles of Marginal Utility Pop Utility 1 120 100 2 70 80 3 60 70 4 10 120 2 3 4 Refer to Table 8.2.2. Henry is maximizing his utility by consuming 3 bags of popcorn and 3 bottles of pop. What is the ratio of the price of popcorn to the price of pop? 3/4 6/5 1/2 1 4/3

Answers

The ratio of the price of popcorn to the price of pop when Henry is maximizing his utility by consuming 3 bags of popcorn and 3 bottles of pop is 6/5. The correct option is B.

According to the data, Henry is maximizing his utility by consuming 3 bags of popcorn and 3 bottles of pop. To find the ratio of the price of popcorn to the price of pop, we need to use the marginal utility of each good and apply the following formula:

Ratio of price of popcorn to price of pop = Marginal utility of pop / Marginal utility of popcorn

From the data, we can see that the marginal utility of pop at 3 bottles is 70, and the marginal utility of popcorn at 3 bags is 60.

Therefore, the ratio of the price of popcorn to the price of pop is:

Ratio of price of popcorn to price of pop = 70 / 60 = 7 / 6 = 1.1667

So the correct answer is 6/5. In conclusion, the ratio of the price of popcorn to the price of pop when Henry is maximizing his utility by consuming 3 bags of popcorn and 3 bottles of pop is 6/5.

Here you can learn more about marginal utility https://brainly.com/question/30841513

#SPJ11

A company had revenues of $75,000 and expenses of $62,000 for the accounting period. The owner withdrew $8,000 in cash during the same period. Which of the following entries could NOT be a closing entry?
a. Debit Revenues $75,000; credit Income Summary $75,000.
b. Debit Income Summary $75,000; credit Revenues $75,000.
c. Debit Income Summary $13,000; credit Owner's, Capital $13,000.
d. Debit Income Summary $62,000, credit Expenses $62,000.

Answers

The correct answer is (b) Debit Income Summary $75,000; credit Revenues $75,000.

This is because option (b) is an incorrect closing entry as it debits the Income Summary account, which should only be credited with the total revenue earned during the period. The correct entry for closing the books would be to debit Income Summary $13,000 (which is the net income) and credit Owner's, Capital $13,000 to reflect the owner's equity in the business.

Option (a) is a correct closing entry, which debits Revenues for the total revenue earned during the period and credits Income Summary for the same amount.

Option (c) is also a correct closing entry, which debits Income Summary for the net income and credits Owner's, Capital to reflect the owner's equity in the business.

Option (d) is a correct closing entry, which debits Income Summary for the total expenses incurred during the period and credits Expenses for the same amount.

Learn more about Debit Income here:

https://brainly.com/question/14912105

#SPJ4

Rob takes a job with Seacoast securities, a FINRA member broker-dealer firm, as a receptionist in a branch. Which of the following activities may violate the rules concerning activities of registered persons?
directing a customer to a flyer for a specific mutual fund rob really likes

Answers

The activities may violate the rules concerning activities of registered person is directing a customer to a flyer for a specific mutual fund rob really likes.

FINRA Rule 2111 (Suitability) requires that broker-dealers and their registered representatives (including receptionists) must have a reasonable basis to believe that any recommended securities transaction or investment strategy is suitable for the customer based on the customer's investment profile.

If Rob directs a customer to a flyer for a specific mutual fund without assessing the customer's investment profile or without having a reasonable basis to believe that the fund is suitable for the customer, this may violate the suitability rule.

Learn more about violate: https://brainly.com/question/14365243

#SPJ4

Contrast the role of fixed costs and variable costs in economic decisions about future production and pricing.

Answers

Fixed costs are sunk costs because they are in the past and cannot be altered. For this reason, fixed costs should play no role in economic decisions about future production or pricing. Variable costs typically show diminishing marginal returns, so that the marginal cost of producing higher levels of output rises.

Why is it important to know what are the fixed and variable costs in a production firm?

Based on a detailed understanding of your company's fixed and variable costs, we can establish the price point that will generate a profit for the products or services that you offer. By using this data, you may calculate your break-even point, which is the amount in units or dollars at which total revenues and total costs are equal.

Variable costs often display declining marginal returns, which causes the marginal cost of producing rising amounts of output to rise with these costs. Variable costs vary depending on how much is generated. Examples of variable expenses include raw materials, commissions, and labour.

To know more about variable costs visit:                    

brainly.com/question/29306232

#SPJ4

Washington company purchases printing equipment for $4,000, paying 40% of the amount due in cash and agreeing to pay the balance at a later date. What is the effect of this transaction on individual asset accounts, individual liability accounts, the Capital Stock account, and the Retained Earnings account?

Answers

The effect of transaction on individual asset accounts, individual liability accounts, Capital Stock account, and Retained Earnings account would be different.

What is Capital Stock?

Capital stock refers to the total amount of common and preferred shares that a company is authorized to issue and sell to its shareholders. This is the amount of money that investors have contributed to a company in exchange for ownership rights. The capital stock of a company represents the long-term funding sources of the organization and serves as a key indicator of its financial health. A company's board of directors determines the number of authorized shares of capital stock, which can be issued to shareholders. These shares represent a claim on the company's assets and earnings, and entitle shareholders to vote at the company's annual meetings, as well as receive dividends if the company generates profits. Capital stock can also be used to raise additional funds through secondary offerings.

Individual Asset Accounts: The purchase of printing equipment will increase the Fixed Asset account by $4,000.

Individual Liability Accounts: The company agreed to pay balance at a later date, which means they have incurred a liability. The Accounts Payable account will increase by $2,400 (60% of $4,000).

Retained Earnings Account: The purchase of equipment does not affect Retained Earnings account.

To learn more about Capital Stock, visit:

https://brainly.com/question/29992715

#SPJ1

Suppose Devon is a fashionista and buys only denim jackets. Devon deposits $4,000 into a savings account that pays an annual nominal interest rate of 10%. Assume this interest rate is fixed, and so it will not change over time.
On the day she makes her deposit, suppose that a denim jacket has a price of $20.00. Initially, Devon's $4,000 deposit has a purchasing power ____ of denim jackets.
For each of the annual inflation rates given in the following table, first determine the new price of a denim jacket, assuming it rises at the rate of inflation. Then enter the corresponding purchasing power of Devon's deposit after one year in the first row of the table for each inflation rate. Finally, enter the value for the real interest rate at each of the given inflation rates. Hint: Round your answers in the first row down to the nearest denim jacket.
For example, if you find that the deposit will cover 20.7 denim jackets, you would round the purchasing power down to 20 denim jackets under the assumption that Devon will not buy seven-tenths of a denim jacket.
Annual Inflation Rate 0% 10% 13%
Number of Jackets Devon Can Purchase after One Year __ 220, 200, 190,174? ___220, 200, 190,174? ___220, 200, 190,174?
Real Interest Rate __% __% __%
When the rate of inflation is greater than the interest rate on Devon's deposit, the purchasing power of her deposit _____ over the course of the year. rises, falls, remains the same?

Answers

Real Interest Rate 10% 0% -3%When the rate of inflation is greater than the interest rate on Devon's deposit, the purchasing power of her deposit falls over the course of the year.

What is real interest rate and inflation rate?

Real interest rates are interest rates that have been modified to take inflation into account. Once modified, it reflects the actual cost of borrowing money for a borrower and the actual yield received by a lender or investment. The rate at which prices increase over a specific time period is known as inflation.

Initially, Devon's $4,000 deposit has a purchasing power of 200 denim jackets ($4,000 ÷ $20.00 per jacket).

Given Annual Inflation Rate 0% 10% 13%
Number of Jackets Devon Can Purchase after One Year 200 180 174

To know more about inflation here
https://brainly.com/question/30112292

#SPJ4

T/F : although producing electricity from burning fossil fuels, such as in coal-fired power plants, is common around the world, some scientists and economists argue that where the geography is appropriate, hydroelectric power is a better method for generating electricity.

Answers

True. Although burning fossil fuels to produce electricity is a standard practise across the world, some scientists and economists contend that hydroelectric power is a more effective way to produce energy in places where it makes sense geographically.

Although burning fossil fuels to produce electricity is a standard practise across the world, some scientists and economists contend that hydroelectric power is a more effective way to produce energy in places where it makes sense geographically. In contrast to using fossil fuels, the process of producing electricity by using hydroelectric power involves transforming the energy of falling water into electrical energy. Hydroelectric power facilities are also usually more efficient than fossil fuel-based power plants and do not emit greenhouse gases, which are a factor in climate change. Hydroelectric power has its own environmental effects, such as the destruction of river ecosystems and the eviction of local inhabitants, and it is not practical in all geographical areas.

learn more about economists here:

https://brainly.com/question/14299791

#SPJ4

the following transactions occur for badger biking company during the month of june: provide services to customers on account for $35,000. purchase bike equipment by signing a note with the bank for $27,000. repay $20,000 of the note in (b) above. pay utilities of $3,500 for the current month. analyze each transaction and indicate the amount of increases and decreases in the accounting equation.

Answers

Analyze each transaction and indicate the amount of increases and decreases in the accounting equation.

Assets   =   Liabilities   +   Equity

$27,000= $3,500+8,000+0

What is an accounting equation?

The accounting equation is a fundamental principle in accounting that states that assets must always equal the sum of liabilities and equity. The equation is expressed as: Assets = Liabilities + Equity

The assets refers to the economic resources owned by a business or individual, such as cash, accounts receivable and liabilities are the financial obligations or debts owed by the business or individual, such as accounts payable, loans, and mortgages.

Learn more about an  accounting equation here:

https://brainly.com/question/28592096

#SPJ1

Darkover Inc., as part of its strategic planning process, is considering making some policy changes. What effect (i.e. Increase, Decrease, No Effect) would each the following changes have on Darkover's Net Cash Flow from Operating Activities? Assume that in each case, the change only affects the account or accounts mentioned (i.e. all other accounts are not changed by the action).1-increase2-no effect3-decrease____2_Increase investment in new plant and equipment._____(1)Change the collections policy to insure that receivables are collected sooner._____(3)Change inventory policy to increase the amount of raw materials kept on hand (work in process and finished goods inventory will remain unchanged)._____(2)Sell long term bonds and use the proceeds to reduce notes payable._____(3) Begin paying all employees every week instead of every two week, effectively decreasing accruals._____(1)Change accounts payable policy to pay bills in 20 days instead of 10 days.

Answers

Cash flows from operating operations can be calculated directly using: wages given to employees. Money given to suppliers and vendors. Cash received from clients.

The net cash flow from operating activities is what?

The net cash flow from operational activities of a business tells us how much more money is entering or leaving its operations. Both changes to non-cash items and to net income are included in this (Sales less any costs, including taxes, depreciation, and cost of goods sold, among others).

How does the cash flow of a company affect notes payable?

Every new loan or note that a business takes on increases the notes payable account on the balance sheet. Its cash flow is improved as a result of receiving funds from the loan. This amount is listed by the company as a cash inflow in the financing operations section of the cash flow statement.

Which of the following adjustments would have an impact on Darkover's net cash flow from operating activities (i.e. an increase, a decrease, or no impact)?no effect- Boost spending on new machinery and equipment.increase- To ensure that receivables are collected sooner, alter the collection policy.decrease- In order to have more raw materials on hand, modify the inventory policy (Inventory of both work in progress and finished goods won't change.). no effect- Modify the policy for accounts payable such that payments are now paid in 20 days rather than 10 days.decrease- Pay all employees weekly beginning today rather than biweekly to minimize accruals.increase- Change the accounts payable policy such that payments are made in 20 days as opposed to 10 days.

Learn more about Cash flows from operating operations: https://brainly.com/question/17001006

#SPJ4

The complete question is:

Darkover Inc., as part of its strategic planning process, is considering making some policy changes. What effect (i.e. Increase, Decrease, No Effect) would each the following changes have on Darkover's Net Cash Flow from Operating Activities? Assume that in each case, the change only affects the account or accounts mentioned (i.e. all other accounts are not changed by the action).1-increase2-no effect3-

_____(a) Increase investment in new plant and equipment.

_____(b)Change the collections policy to insure that receivables are collected sooner.

_____(c)Change inventory policy to increase the amount of raw materials kept on hand (work in process and finished goods inventory will remain unchanged).

_____(d)Sell long term bonds and use the proceeds to reduce notes payable

_____(e) Begin paying all employees every week instead of every two week, effectively decreasing accruals.

_____(f)Change accounts payable policy to pay bills in 20 days instead of 10 days.

when alma arrived to her economics class, she quickly wrote down everything the teacher had outlined on the board, word for word. this is a good note taking strategy because

Answers

This is a useful note-taking strategy because it permits precise and thorough information collection, reducing the possibility of overlooking crucial particulars.

The method Alma used to take note-taking strategy what the instructor said on the board—can be beneficial for a variety of reasons. First of all, it enables her to remember all of the important ideas and facts that were covered in class. This is especially helpful if the subject matter discussed is intricate or substantial. Second, having a comprehensive collection of notes might make it simpler to review the content later on and prepare for tests. Thirdly, it can act as a fallback in case anything is forgotten or missed during the lesson. It is crucial to remember that this approach might not be effective for all pupils because some could find it challenging to maintain their focus while taking in-depth notes at the same time.

learn more about note-taking strategy here:

https://brainly.com/question/11068259

#SPJ4

If a company has financial difficulties, which of the following has the highest priority for repayment?
Individuals who purchased bonds from the company.

Answers

Individuals who purchased bonds from the company have the highest priority for repayment in case of financial difficulties.

The reason for this is that bonds are considered debt instruments and bondholders are considered creditors. The company has a legal obligation to pay back the principal amount and interest to the bondholders before any other payment to shareholders or other stakeholders.

Bonds are issued by companies to borrow money from investors.

Bondholders are creditors of the company and have a legal claim on the assets of the company.

In case of financial difficulties, the company must prioritize the repayment of its debts, including bonds.

Bondholders have the highest priority for repayment, followed by other creditors such as banks or suppliers.

Shareholders, on the other hand, have a lower priority and may not receive any payment if the company is unable to repay its debts.

In summary, bondholders have the highest priority for repayment in case of financial difficulties as they are considered as creditors of the company.

This is because bonds are debt instruments that create a legal obligation for the company to repay the principal amount and interest to the bondholders before any other payment to shareholders or other stakeholders.

For more questions like Financial click the link below:

https://brainly.com/question/29979828

#SPJ4

knowledge check 01 a buyer uses a periodic inventory system, and on december 5, it purchases $4,000 of merchandise on credit terms of 2/10, n/30. complete the journal entry by selecting the account names from the drop-down menus and entering the dollar amounts in the debit or credit columns.

Answers

The answer is Dr. - Merchandise Inventory $4,00 to Cr. - Accounts Payable $4,000, is the complete journal entry for the equation.

What do you mean by inventory?

All of the goods, merchandise, and supplies that a company keeps on hand in anticipation of selling them for a profit are referred to as inventory. Example: If a newspaper seller utilizes a vehicle to deliver newspapers to consumers, just the newspapers will be counted as inventory. The car will be handled as an asset.

What is the primary function of inventory?

The goal of the inventory is to act as a buffer between production and sales, regulating the flow of goods and guaranteeing that commodities are available when customers place orders. Companies must carefully control their inventory levels to accomplish this goal, possibly investing in the right method.

To know more about Inventory visit:

https://brainly.com/question/14184995

#SPJ4

Which of the following are steps in the closing process? Select all that apply.
a) Nominal accounts are reset to zero.
b) Real accounts are reset to zero.
c) Net income is transferred to the cash account on the balance sheet.
d) Net income is transferred to the retained earnings account on the balance sheet.
e) The retained earnings account is reset to zero.

Answers

The correct option is A. In the closing process, Nominal accounts are reset to zero.

An account is a particular report inside an employer's financial ledger or balance sheet. Accountants, finance experts, and bookkeepers can use debts to report important financial records, like reporting day-by-day transactions to confirm the exact amount of money an organization has at any moment.

In accounting, an account is a document within the famous ledger this is used to kind and maintain transactions. as an example, groups may additionally have an account of a coin wherein to file every transaction so one can increase or decreases the business enterprise's cash. fundamental accounting ideas used in commercial organizations globally cover income, charges, belongings, and liabilities. the one's elements are tracked and recorded in documents which encompass stability sheets, income statements, and cash glide statements.

To learn more about Account visit here:

brainly.com/question/22917325

#SPJ4

Eleanor wants to repeat the first row of the worksheet on each printed page of a four-page worksheet. Which of the following options should she use in the Page Setup dialog box?
a. Print area
b. Row and column headings
c. Print titles
d. Gridlines

Answers

Eleanor wants to repeat the first row of the worksheet on each printed page of a four-page worksheet of the following options should she use in the Page Setup dialog box  Row and column headings.

How can I get Excel to repeat the first row across all pages?

Navigate to the [Page Layout] tab. Click [Print Titles] in the "Page Setup" group. Click the spreadsheet icon in the "Rows to repeat at top" section under the [Sheet] tab. The row you want to appear at the top of each page can be chosen by clicking on it. Click [OK] after pressing the [Enter] key.

In Excel, how do I duplicate rows?

Click Page Setup under the Page Setup group on the Page Layout tab. Select the column or row that contains the titles you wish to repeat by clicking under Rows to repeat at the top or Columns to repeat at the left under Print Titles. Select OK.

To Know more about column headings.

https://brainly.com/question/13163317

#SPJ4

which of the following are normally included in a credit application? (choose every correct answer.)

Answers

The following are normally included in a credit application:

Other credit relationshipsBank accountsLiabilities

What is credit applications?

Credit applications typically request information about a borrower's financial situation, including other credit relationships, bank accounts, and liabilities.

This information is used by lenders to evaluate the borrower's creditworthiness and ability to repay the loan. Information about family life and driving record is generally not relevant to the credit application process.

Learn more about credit application here:https://brainly.com/question/13964348

#SPJ1

The complete question  is:

Which of the following are normally included in a credit application? Information about: (Select all that apply)

- Family life

- Other credit relationships

- Bank accounts

- Liabilities

- Driving record

During an internal business presentation, a speaker's credibility can be increased through which two of the following?demonstrating knowledge about a business issue.explaining how a business idea will improve the company.

Answers

During an internal business presentation, a speaker's credibility can be increased through:

A. demonstrating knowledge about a business issueC. explaining how a business idea will improve the company

What is demonstrating knowledge about a business issue?

Demonstrating knowledge about a business issue shows that the speaker has done their research and understands the topic at hand, which can help build trust with the audience. It can also show that the speaker is well-informed and authoritative on the subject, which can help to establish their credibility.

Explaining how a business idea will improve the company shows that the speaker has thought carefully about their proposal and has a clear understanding of how it can benefit the organization. It can help to persuade the audience that the proposal is worth considering and that the speaker has the expertise and knowledge to implement it successfully.

Both of these factors can work together to increase the speaker's credibility and make their presentation more effective in influencing the audience.

Therefore the correct option is A, C.

Learn more about credibility  here:https://brainly.com/question/1279931

#SPJ1

purchasing a machine for cash is an example of decrease in asset and as decrease in liability

Answers

Option a) decrease in asset and as decrease in liability suits the given example of 'purchasing a machine for cash'.

In financial accounting, a liability is defined as a future sacrifice of economic benefit that an enterprise must make to another enterprise as a result of past transactions or other past events, the settlement of which is the transfer or use of an asset. can result in provision of services or other future economic benefits.

A liability is defined by the following characteristics:

Borrowing of any kind from individuals or banks to improve business or personal income payable in the short or long term.

Obligation to others to effect future transfer or use of assets, performance of services, or other settlement of any economic interest upon the occurrence of a specified event or upon request at a specified or determinable time. Or liability.

An obligation or liability that imposes another obligation on the company and leaves little or no discretion to avoid settlement. and,

A transaction that has already occurred or an event mandated by the company

To learn more about liability, here:

https://brainly.com/question/24077611

#SPJ4

Complete question:

Purchasing a machine for cash is an example of

a) decrease in asset and as decrease in liability

b) An increase in an asset and an increase in an another asset.

c) an increase in asset and an decrease in an another asset.

d) an increase in liability and a decrease in an stockholders' equity account.

Presented below are selected transactions on the books of Simonson Corporation.
May 1, 2010 - Bonds payable with a par value of $900,000, which are dated January 1, 2010, are sold at 106 plus accrued interest. They are coupon bonds, bear interest at 12% (payable annually at January 1), and mature January 1, 2020. (Use interest expense account for accrued interest.)
Dec 31 - Adjusting entries are made to record the accrued interest on the bonds, and the amortization of the proper amount of premium. (Use straight line amortization.)
Jan. 1, 2011 - Interest on the bonds is paid.
April 1 - Bonds of par value of $360,000 are called at 102 plus accrued interest, and retired. (Bond premium is to be amortized only at the end of each year.)
Dec 31 - Adjusting entries are made to record the accrued interest on the bonds, and the proper amount of premium amortized.
Instructions:
Prepare the journal entries for the transactions above.

Answers

A journal entry is a written record of an individual's thoughts,  observations that are typically recorded on a regular basis, such as daily

The journal entries are as follows:

May 1, 2010:

Cash $954,000

Bonds Payable $900,000

Premium on Bonds Payable $54,000

Interest Expense $36,000

Cash $36,000

Premium on Bonds Payable $9,000

Interest Expense $9,000

Dec 31:

Interest Expense $72,000

Interest Payable $72,000

Premium on Bonds Payable $9,000

Interest Expense $9,000

Jan. 1, 2011:

Interest Expense $108,000

Cash $108,000

April 1:

Bonds Payable $360,000

Loss on Bond Redemption $3,600

Premium on Bonds Payable $9,000

Cash $367,200

Dec 31:

Interest Expense $32,400

Interest Payable $32,400

learn more about journal here:

https://brainly.com/question/29726075

#SPJ4

The prepaid insurance balance reflects a 12-month insurance policy which started on Sept. 1, 2018, and no adjustments were made from Sept. 1 – Dec. 31, 2018. Write the adjusting journal entry for Dec. 31, 2018. In Blank [1] enter the account to be debited. In Blank [2] enter the amount to be debited. In Blank [3] enter the account to be credited. In Blank [4] enter the amount to be credited.
Dr. [1]_______________ [2]$_____________
Cr. [3]________________ [4]$____________

Answers

The journal entry will be Debit- Insurance exp. and credit Prepaid insurance.

What is a journal entry?

A journal entry is a record of a commercial transaction made in an organization's accounting system. The double-entry accounting method, which has been around for centuries, is built on the foundation of journal entries.

Ledgers are what?

With debit and credit account entries verified by a trial balance, a general ledger serves as the mechanism for maintaining a company's financial data. A permanent summary of all sums recorded in supporting journals, which identify specific transactions by date, is kept in the ledger. Each transaction starts in a journal and moves through one or more ledgers. The summary totals in the ledgers are used to create the financial statements for a corporation.

To know more about journal entries visit:

https://brainly.com/question/20421012

#SPJ4

a broker has found a buyer for a seller's home. the buyer has indicated in writing his willingness to buy the property for $1,000 less than the asking price and has deposited $5,000 in earnest money with the broker. the seller is out of town for the weekend, and the broker has been unable to inform him of the signed document. at this point, the buyer has signed

Answers

Option (c), The broker was unable to notify the seller of the signed agreements because he is out of town for the weekend. The document is currently an Offer.

What are the most important three legal documents for any real estate transaction, and why?

The three original documents that are deemed to be the most significant are the purchase agreement, a deed, and any mortgage or trust deed. If the originals are lost or destroyed, you might be able to obtain certified copies of these documents from the lender or closing company, but unless absolutely essential, you should just not reliance on someone else's record-keeping practices.

Which legal documents are given to the buyer?

A set of conditions that are outlined in the Sale and Purchase Agreement have been accepted by both the buyer and the seller. One of the clearest examples of this is the discussion on the price of the apartment at the time it was purchased. The agreement would include the apartment's agreed-upon valuation, which the buyer and seller had agreed upon.

Learn more about Sale and Purchase Agreement: https://brainly.com/question/20813218

#SPJ4

The complete question is:

A real estate professional has found a buyer for a seller's home. The buyer has indicated in writing a willingness to buy the property for $1,000 less than the asking price and has deposited $5,000 in earnest money with the real estate professional. The seller is out of town for the weekend, and the real estate professional has been unable to inform the seller of the signed document. At this point, the buyer has

A) a voidable contract

B) an executory agreement

C) an offer

D) an implied contract

The technological conservatism of bicycle manufacturers is a reflection of the kinds of demand they are trying to meet. The only cyclists seriously interested in innovation and willing to pay for it are bicycle racers. Therefore, innovation in bicycle technology is limited by what authorities will accept as standard for purposes of competition in bicycle races.
Which of following is an assumption made in drawing the conclusion above?
(A) The market for cheap, traditional bicycle cannot expand unless the market for high-performance competition bicycles expands.
(B) High-performance bicycles are likely to be improved more as a result of technological innovations developed in small workshops than as a result of technological innovations developed in major manufacturing concerns.
(C) Bicycle racers do not generate a strong demand for innovations that fall outside what is officially recognized as standard for purpose of competition.
(D) The technology conservatism of bicycle manufacturers results primarily from their desire to manufacturer a product that can be sold without being altered to suit different national markets.
(E) The authorities who set standards for high-performance bicycle racing do not keep informed about innovative bicycle design.

Answers

Option C is correct, bicycle racers do not generate a strong demand for innovations that fall outside what is officially recognized as standard for purpose of competition.

What is bicycle industry?

The sector of the economy that deals with bicycles and cycling is known as the "bicycle industry" or "cycling industry." It comprises at the very least accessory and part makers as well as bicycle manufacturers.

What is technical conservatism?

A technology that is already part of your stack should be preferred, but only if it is the best choice. This is known as technical conservatism. An current technology may not be suitable in some circumstances.

To know more about purpose of competition visit:                    brainly.com/question/13177537

#SPJ4

peron company uses a perpetual inventory system and the net method of recording invoices. the company purchased merchandise on november 4 at a $2,000 invoice price with terms of 2/10, n/30. complete the journal entry by selecting the account names from the drop-down menus and the amounts in the debit and credit columns.

Answers

The journal entry to record the purchase on November 4 would be: The Purchase Discounts account is a contra-expense account that is credited when the company takes advantage of a discount. By crediting this account, the company records the reduction in the cost of goods sold due to the discount.

The image of the journal  is attached below

What is journal entry?

Generally, the image below

Since Peron Company uses a perpetual inventory system, it records each purchase of merchandise into the Merchandise Inventory account, which is a current asset account that reflects the cost of goods available for sale.

Since the invoice terms are 2/10, n/30, the company can take a 2% discount if it pays within 10 days. The discount is calculated as 2% of the invoice price, or $40 ($2,000 x 2%). The net amount due is $1,960 ($2,000 - $40).

Since the company is using the net method of recording invoices, it records the net amount due in the Accounts Payable account, which is a current liability account that reflects the amount owed to the vendor.

Read more about journal entry

https://brainly.com/question/20421012

#SPJ1

(08.03 lc) which of these was a consequence of the civil war? general william tecumseh sherman's march to the sea destroyed southern transportation lines. president lincoln's gettysburg address persuaded the south to disarm and surrender. maryland became a territory due to the writ of habeas corpus. the southern states gained a new primary source of income.

Answers

Option (a),  As a result of the civil war, General William Tecumseh Sherman's March to the Sea damaged Southern transportation routes.

What happened with Sherman's March to the Sea?

The purpose of Sherman's March to the Sea was to scare Georgian citizens into siding with the Union rather than the Confederacy. Although Sherman's men did not burn any cities in their path, they did stole food and livestock and set fire to the homes and barns of locals who tried to rebuff them.

What effect on the American Civil War did Sherman's March to the Sea have?

The Atlanta Campaign and Sherman's March to the Sea may have influenced the result of the Civil War in the Union's favor. Due to the operation's destruction, which led to significant financial loss and low morale for the Confederacy, Southerners retained tremendous resentment toward the Confederacy.

Learn more about General William Tecumseh Sherman's March: https://brainly.com/question/1413114

#SPJ4

The complete question is:

Which of these was a consequence of the civil war?

(a). General William Tecumseh Sherman's march to the sea destroyed southern transportation lines.

(b). President Lincoln's Gettysburg address persuaded the south to disarm and surrender.

(c). Maryland became a territory due to the writ of habeas corpus.

(d). The southern states gained a new primary source of income.

in year 1, frill corp. issued 1,000 shares of $1 par value common stock for $10 per share. in year 3, frill repurchased and immediately retired 100 shares of the stock at $12 per share. which of the following entries would be included in the journal entry to retire the shares? (select all that apply.)

Answers

Based on this analysis, the following entries would be included in the journal entry to retire the shares: Debit: Common Stock $100;Debit: Additional Paid-in Capital $1,100;Credit: Cash $1,200

There are a few possible ways to approach this question, but one common method is to  the effects of the stock issuance and repurchase on Frill Corp.'s accounts and then determine which accounts need to be adjusted in the journal entry to retire the shares. Here's one possible solution:Year 1 stock issuance:

Debit: Cash $10,000 (1,000 shares x $10 per share)

Credit: Common Stock $1,000 (1,000 shares x $1 par value)

Credit: Additional Paid-in Capital $9,000 (the excess of the issuance price over the par value)

Year 3 stock repurchase and retirement:

Debit: Common Stock $100 (100 shares x $1 par value)

Debit: Additional Paid-in Capital $1,100 (the excess of the repurchase price over the par value and the original issuance price)

Credit: Cash $1,200 (100 shares x $12 per share)

Based on this analysis, the following entries would be included in the journal entry to retire the shares:

Debit: Common Stock $100

Debit: Additional Paid-in Capital $1,100

Credit: Cash $1,200

Therefore, the correct options are:

Debit: Common Stock

Debit: Additional Paid-in Capital

Credit: Cash

Note that the total amount debited ($1,200) equals the total amount credited ($1,200), which ensures that the journal entry is balanced. Also, the retirement of the shares reduces the total number of outstanding shares from 1,000 to 900 (1,000 - 100), which may affect the calculation of earnings per share and other financial ratios.

To know more about Common Stock:

https://brainly.com/question/13762106

#SPJ4

Refer to Figure 5-2. If the tuition is set at $70 there will be

a.
a shortage at 10 a.m. and a surplus at 8 a.m.


b.
a surplus at 10 a.m. and a shortage at 8 a.m.


c.
equilibrium at 10 a.m. and a surplus of seats at 8 a.m.


d.
equilibrium at 10 a.m. and a shortage of seats at 8 a.m.

Answers

If the tuition is set at $70 there will be a surplus at 10 a.m. and a shortage at 8 a.m. Hence, option B is correct.

What is meant by surplus?

An item or resource that has more than is currently being used is said to have a surplus. A surplus can relate to a wide range of things, including money, goods, capital, and profits.

When you have more of anything than you need or intend to utilize, you have a surplus. When you prepare a meal, for instance, you have an excess of food if there is any left over after everyone has finished eating.

Thus, option B is correct.

For more information about surplus, click here:

https://brainly.com/question/15392268

#SPJ1

Other Questions
Three basic team member types exist within a typical Six Sigma Project Team; ________ members provide expert information, council, or help in accessing resources when called upon by the project team leader, ________ members participate in all activities of the team and attend as many team meetings as possible, and ________ members provide expertise on an as-needed basis as subject matter expertsa. resource, regular, ad hocb. regular, resource, ad hocc. ad hoc, resource, regulard. ad hoc, regular, resource. if we change the constraint quantity to a value outside the sensitivity range for that constraint quantity, the shadow price will change. What are the most common restaurant food safety risks? Multiple Select QuestionSelect all that applySelect all the statements that correctly describe organometallic reagents.A.Organometallic reagents are good nucleophiles and strong bases.B.Organometallic reagents are ionic since they contain a bond between a metal and a nonmetal.C.Organometallic reagents are a source of electrophilic carbon.D.These reagents contain a polar carbon-metal bond. If you showed a 2-year-old that you'd hidden a toy behind the bed in a model of her bedroom, she would not be able to find the toy in her real bedroom because she lacksanswer choicesO analytical thinking.O random thinking.O critical thinking.O schematic thinking.O egocentric thinking. what did george washington believe was the proper solution to the indian problem? he piece of DNA written below was found by an undergraduate researcher while examining a novel bacteria strain. Show the undergraduate researcher what the doublestranded DNA would look like for this single strand of DNA. Make sure you show all important chemical components that describe DNA orientation.5 GGCGAATCATGCGCTGCCTTGTTTCCACTAGTAGACGCGGGACTTGGTTTCACACATGACGCGT An instructor grades on a curve (normal distribution) and your grade for each test is determined by the following where S = your score. A-grade: Su + 20 B-grade: u + OSS< + 20 C-grade: u-OSS What is energy efficiency in dishwater? Write an algebraic expression to represent the following situation: "Greg has nickels and pennies in his pocket. The number of pennies is 7 less than twice the number of nickels. Let N represent the number the nickels. Write an expression for the number of pennies." 3. Which is the first step in setting a financial goal? who moved my cheese summary PART THREE: LESSON 07.04 INTRODUCTIONS IN ARGUMENT WRITINGSubmit the introductory paragraph of seven to 10 sentences. Be sure to include your claim and briefly mention the counterclaim.Can a PSA help reduce the number of distracted driving incidents? PSA are useful in decreasing driving incidents, they let the audience see for themselves the awful impacts of texting and driving. PSA prove and repeat the audience to not text and drive. Here is a graph of F and G. 1. Describe three goals of the NewDeal. What is the approximate area of the geometric figure?ResponsesA 10 square units10 square unitsB 8 square units8 square unitsC 5 square units5 square unitsD 2 square units2 square unitsE 3 square units Let A be a 3x4 matrix with reduced row echelon form given byU= 102101120000a1= 231a2 = -23-3 What is the acceleration of gravity on Mercury? Can someone please help me with this? Show work please What is the story of The Rising of the Moon?