what year was the first world war?

Answers

Answer 1

Answer:

1918

Explanation:

I THINK ITS HELP GOOD LUCK

Answer 2

Answer:

from 1914 to 1918________________PLEASE FOLLOW ME


Related Questions

Johnson’s two civil rights laws are considered to be landmarks in american history?

Answers

The two civil rights laws passed by President Lyndon B. Johnson in the 1960s are often considered the most significant pieces of civil rights legislation in American history.

The Civil Rights Act of 1964 outlawed discrimination based on race, color, religion, sex, or national origin. It also prohibited unequal application of voting requirements, and gave the federal government the power to enforce desegregation of the public schools and other public facilities.

The Voting Rights Act of 1965 eliminated literacy tests, poll taxes, and other discriminatory voting practices, and provided for federal oversight of elections in states with a history of racially-biased voting rules. These two laws had an enormous impact on the civil rights movement, as they provided a legal framework for the advancement of civil rights, and provided protection from discrimination.

know more about civil rights here

https://brainly.com/question/1142564#

#SPJ11

Help me, please!
Five challenges that bureaucracy presented to the country in how each of these agencies behaved, and five ways in which information in your chapter on "The Bureaucracy" in American Democracy Now was represented in this Frontline documentary.

Answers

The bureaucracy presented challenges such as inefficiency, and the Frontline documentary represented information about bureaucracy's role in implementing policy, the tension between political leadership and bureaucracy,  civil service reform, and bureaucratic discretion and control.

In terms of the challenges that bureaucracy presents to the country, there are several that come to mind. One is the issue of bureaucracy being slow to respond to changing circumstances, which can be particularly problematic in times of crisis.

Another challenge is the potential for bureaucracy to become overly bureaucratic, with excessive regulations and rules that can impede innovation and progress.

Additionally, there can be issues with bureaucracy becoming too entrenched in certain practices, which can make it difficult to implement meaningful reforms or changes.

Other challenges include issues with bureaucracy being too focused on process rather than outcomes, and with bureaucracy being too insulated from public scrutiny and accountability.

In terms of ways in which information in the chapter on "The Bureaucracy" in American Democracy Now was represented in the Frontline documentary, there are several key themes that were highlighted.

One is the role of bureaucracy in implementing government policies and programs, with a focus on the ways in which bureaucracy can shape the effectiveness and impact of these initiatives.

Another theme is the potential for bureaucracy to become politicized, with agencies and officials being swayed by partisan politics rather than focusing on the public good.

The documentary also touched on the issue of bureaucracy being slow to change and adapt to new circumstances, particularly in the face of emerging challenges like climate change.

Overall, the documentary provided a nuanced and insightful look at the challenges and opportunities presented by bureaucracy in American democracy.

For more question on bureaucracy visit:

https://brainly.com/question/12430754

#SPJ11

Which label applies to dinosaurs that ate only meat?



A. Grippers


B. Snippers


C. Stabbers


D. Grinders

Answers

The label that applies to dinosaurs that ate only meat is "Carnivores."  Carnivorous dinosaurs were well-adapted to hunting and capturing

Carnivores are animals that primarily or exclusively consume meat. In the context of dinosaurs, the term "carnivore" is used to describe those species that had a diet consisting solely of other animals. Carnivorous dinosaurs were well-adapted to hunting and capturing their prey, often possessing sharp teeth, strong jaws, and agile bodies to pursue and capture their food.

Options A, B, C, and D do not accurately describe the dietary habits of meat-eating dinosaurs. Grippers, snippers, stabbers, and grinders are not specific terms used to refer to carnivorous dinosaurs but rather describe different types of feeding mechanisms or actions.

Therefore, the correct label for dinosaurs that ate only meat is "carnivores." These dinosaurs played an important role in the prehistoric ecosystem as top predators, and their feeding habits were crucial to understanding the dynamics of ancient food chains.

Learn more about food chains here:

https://brainly.com/question/29767237

#SPJ11

what even marked the start of World War 2

Answers

September. 1, 1939: Germany invades Poland, marking what many regard as the start of the war, though Japan invaded China on July 7, 1937.

Evaluate the Scramble for Africa in light of the concepts of justice, power, and citizenship.

Answers

It refers to the European powers' competition for African colonies during the "Scramble for Africa." It took place at the end of the 19th century and the beginning of the 20th.

The European nations' competition for control of the most prosperous and influential African colonies is referred to as "Scramble for Africa." European superpowers decided to control how the African continent was divided after the Berlin Conference in 1844–1845.

By 1900, seven major European powers had colonized a significant portion of Africa. For the Africans, government had various adverse consequences, including the deficiency of their regular assets, work abuse, and oppressive tax assessment.

Find out more about the fight for Africa here:

https://brainly.com/question/7738545

#SPJ1

Which of the following was an effect of U. S. Cold War era interference in Africa, Latin America, and the Middle East?.

Answers

U.S. Cold War era interference in Africa, Latin America, and the Middle East had various effects on these regions.

One significant effect of U.S. Cold War era interference was political destabilization. The United States often supported authoritarian regimes or engaged in covert operations to overthrow democratically elected governments, leading to political unrest and instability. Additionally, U.S. interventions often exacerbated socioeconomic inequalities and human rights abuses, causing social and economic upheaval. These interventions also fueled anti-American sentiment and contributed to the rise of nationalist and anti-imperialist movements in these regions. Overall, U.S. interference during the Cold War era left a lasting impact on Africa, Latin America, and the Middle East, shaping their political, social, and economic landscapes.

Learn more about  U.S. Cold War-era interference here:

https://brainly.com/question/30908547

#SPJ11

which word best fits in the blank? The girls' basketball team hopes to _______ their top rivals in the game tonight A Lament B Annihilate C Exodus D Veritable?​

Answers

Answer:

B Annihilate

Explanation:

because its the only one that makes sense about beating their top rivals

The function, f, is defined by representing the amount of money in a bank account years after it was opened. How much money was in the account when it was opened?

Answers

The given information does not provide enough details to determine the exact amount of money in the bank account when it was opened. Further information or context is needed to determine the initial deposit or balance.

To determine the amount of money in the account when it was opened, specific information such as the initial deposit or balance is required. The function f, representing the amount of money in the account after a certain number of years, may provide insights into the growth or decline of the account balance over time. However, without additional information, it is not possible to determine the exact initial amount.

The function f might involve factors such as interest rates, deposits, withdrawals, or other financial transactions that affect the account balance over time. By analyzing the function and its variables, one could potentially estimate the initial amount, assuming other variables are known. However, without specific information or context, it is not possible to provide a precise answer regarding the initial amount of money in the account when it was opened.

Learn more about initial deposit here:

https://brainly.com/question/14757536

#SPJ11

Why was A. Mitchell Palmer called "a red-blooded patriot"?

Answers

A. Mitchell Palmer was called "a red-blooded patriot" because of his attempts to protect America's interests in the aftermath of World War I.

His loyalty to his country was widely recognized, and he was well-respected for his stance against radicalism and any form of political unrest. In addition, Palmer was a strong supporter of President Wilson's administration, which further contributed to his reputation as a patriotic leader.

His aggressive campaign against communism and the Red Scare in 1919, known as the Palmer Raids, further cemented his image as a patriotic figure.

The Palmer Raids resulted in the arrest and deportation of thousands of suspected radicals, including labor leaders and immigrants.

Despite criticism from civil liberties groups and some politicians, Palmer defended his actions as necessary to protect the country's security. As a result, he became known as a strong defender of American democracy and values.

For more answers on America

https://brainly.com/question/28994954

#SPJ8

how did nipsey understand south central and the history of los angeles?

Answers

Nipsey Hussle was a rapper and activist from South Central Los Angeles who had a deep understanding of the history of his community and the broader city of Los Angeles.

He grew up in an area that had been devastated by poverty, gang violence, and the war on drugs, and he witnessed firsthand the effects of systemic racism and inequality.Nipsey was deeply committed to empowering his community and changing the narrative of South Central Los Angeles. He was a vocal advocate for education, entrepreneurship, and economic development, and he believed that by investing in the community and creating opportunities for its residents, they could break the cycle of poverty and violence that had plagued the area for decades.

Nipsey's understanding of South Central and Los Angeles was rooted in his personal experiences, as well as his extensive research and study of the history of the city. He was known for his insightful lyrics and interviews, in which he discussed topics such as the crack epidemic, police brutality, and the legacy of gang culture in LA. Nipsey's legacy continues to inspire and motivate people to create positive change in their communities.

To know more about Los Angeles click here

brainly.com/question/13199114

#SPJ11

the sub-field of world history, as of late, has increasingly involved some aspects of the history of the cosmos. how do you explain the need to include that form of history in world history?

Answers

Including the history of the cosmos in world history provides valuable context, fosters interdisciplinary collaboration, helps us comprehend global phenomena, and encourages curiosity and critical thinking.

The inclusion of cosmic history in world history is essential for several reasons:

1. Contextualizing human history: By studying the history of the cosmos, we gain a broader perspective on human history, allowing us to understand our place within the universe and the timeline of events that led to our existence.

2. Interdisciplinary approach: Including cosmic history in world history encourages collaboration between historians and scientists from various fields, such as astronomy, geology, and physics. This interdisciplinary approach enriches our understanding of the past and fosters new discoveries.

3. Comprehending global phenomena: Cosmic events, such as asteroid impacts, solar flares, and climate changes, have had significant impacts on Earth's history and human civilizations. Studying these events can provide insights into the development of human societies and the natural environment.

4. Fostering curiosity and critical thinking: Understanding the history of the cosmos helps spark curiosity about our origins and encourages critical thinking about the vastness and complexity of the universe.

This integration enhances our understanding of both human history and the universe as a whole.

Learn more about World history:

https://brainly.com/question/25670011

#SPJ11

What was the “Iron Curtain” that Winston Churchill referred to?

A wall of Soviet missiles positioned along its border

A way to push the Soviet Union out of Eastern Europe

An imaginary line that separated communist countries from free countries in Europe

is An imaginary line that separated communist countries from free countries in Europe

Answers

Answer:

nn

Explanation:

Read an excerpt from Benito Mussolini’s "The Doctrine of Fascism.”

In the Fascist State, the individual is not suppressed, but rather multiplied, just as in a regiment a soldier is not weakened, but multiplied by the number of his comrades. The Fascist State organizes the nation, but it leaves sufficient scope for individuals; it has limited useless or harmful liberties and has preserved those that are essential. It cannot be the individual who decides in this matter, but only the State.

This excerpt could best be used to support a document-based essay on

Mussolini’s fall from power.
Mussolini’s role in World War II.
the ideology of fascism in Italy.
the format of elections in Italy.

Answers

The ideology of fascism in Italy.

Please let me know if i’m wrong, thank you!

True/False: during docility, a person lets the environment dictate their behavior.

Answers

The given statement "During docility, a person lets the environment dictate their behavior" is True because, During docility, a person allows the environment to influence their behavior.

Docility refers to the state or quality of being teachable, receptive, or easily managed. In this context, an individual becomes open to the impact of their surroundings and may adopt behaviors, attitudes, or beliefs that align with their environment. This adaptability is essential for learning and adjusting to new situations.

The environment, including social and physical aspects, plays a crucial role in shaping one's behavior. This process can be observed in social learning theory, which emphasizes the importance of observational learning and imitation. When people are exposed to certain behaviors or norms, they may adopt them to conform or fit in.

Docility can be beneficial in some instances, such as when adjusting to a new culture or workplace, as it allows the individual to adapt and thrive. However, excessive docility may lead to conformity or a lack of critical thinking, as people may uncritically accept information or imitate behaviors without questioning them.

In summary, during docility, it is true that a person allows the environment to dictate their behavior, but the degree to which this occurs can vary among individuals. It is essential to strike a balance between adaptability and maintaining one's values and critical thinking skills.

Know more about Docility here:

https://brainly.com/question/30551539

#SPJ11

In presidential elections, the electoral college encourages candidates to spend time in both the big cities and smaller towns in battleground states. Group of answer choices

True

False

Answers

True. In presidential elections, the electoral college encourages candidates to spend time in both big cities and smaller towns in battleground states.

The electoral college system in the United States assigns a certain number of electors to each state based on its representation in Congress. This means that candidates must secure a majority of electoral votes to win the presidency. As a result, candidates focus their campaign efforts on swing states or battleground states where the outcome is uncertain and the allocation of electoral votes is competitive. Battleground states often include a mix of urban areas, big cities, and smaller towns. To win the support of these states, candidates need to engage with voters across various regions, including both densely populated urban centers and less populated rural areas. This encourages candidates to campaign in a diverse range of communities within battleground states.

Learn more about  the electoral college here:

https://brainly.com/question/1042279

#SPJ11

How has farming in the United States changed in the last 50–100 years?

Responses


a Farms have gotten bigger, and the number of farms has declined.


b American farms now produce mostly grain products.


c The number of people becoming farmers has increased steadily.



d Most farms now grow food using organic methods.

first person gets brainiest

Answers

Answer:

Now THAT'S ALOTTA POINTS

Explanation:

The correct response is:

a. Farms have gotten bigger, and the number of farms has declined.

In the last 50-100 years, farming in the United States has experienced significant changes. One major trend is the consolidation of farms, leading to larger farm sizes. This has been driven by advancements in technology, machinery, and agricultural practices, allowing for increased efficiency and productivity. As a result, the number of farms has declined as smaller farms have been absorbed or replaced by larger operations.

Answer:

a Farms have gotten bigger, and the number of farms has declined.

Explanation:

Since 1950 an average farm size has doubled, but the number of laborers decreased substantially and the number of small local farmers has been cut in half. Farmers have been forced to become more efficient and there 's been a reliance on greater chemicals and technology, which has become very extensive and expensive.

True or false britain began practicing mercantilism after the french-indian war doubled their national debt

Answers

False. Britain had been practicing mercantilism long before the French-Indian War and the subsequent increase in national debt.

Mercantilism was an economic theory and policy that was prevalent in Europe during the 16th to 18th centuries, including in Britain. It emphasized the accumulation of wealth through a favorable balance of trade, the establishment of colonies, and the regulation of industry and commerce to benefit the mother country. Britain had already been implementing mercantilist policies, such as navigation acts and trade restrictions, prior to the French-Indian War. The war did lead to a significant increase in Britain's national debt, but it did not prompt the ad of mercantilism.

Learn more about policy here:

https://brainly.com/question/13036064

#SPJ11

this greek doctor could not dissect humans so he dissected animals instead

Answers

Answer: The Greek doctor who could not dissect humans and therefore dissected animals instead was Galen (129-200 AD). Galen was a prominent physician, anatomist, and philosopher in ancient Rome, and he is considered one of the most important figures in the history of medicine. Galen's work was heavily influenced by the teachings of the ancient Greek physician Hippocrates and he is known for his extensive writings on anatomy, physiology, pathology, and pharmacology. While Galen was unable to perform human dissections due to cultural and religious beliefs, he was able to perform dissections on animals, such as monkeys and pigs, and he used his findings to develop his understanding of human anatomy and physiology. Galen's work was highly influential in the development of Western medicine and his ideas remained prominent for centuries after his death.

During the time of Galen, dissection of human bodies was prohibited due to cultural and religious beliefs. The ancient Greeks believed that the body should remain intact even after death and that dissection was a violation of the body's sanctity. This belief persisted into the Roman era and beyond, which made it difficult for anatomists and physicians like Galen to study human anatomy directly.

As a result, Galen turned to animal dissection as an alternative. He dissected a variety of animals, including monkeys, pigs, and goats, and studied their anatomy and physiology. He also observed animals in nature, making important discoveries about their behavior and biology.

Galen's extensive writings on anatomy and physiology, which included detailed descriptions of the structures and functions of various organs and systems in the body, became foundational texts in the study of medicine. Even though Galen's knowledge of anatomy was based largely on animal dissections, his work was still influential and useful for generations of physicians and anatomists. It wasn't until many centuries later, during the Renaissance, that the human dissection became more accepted, which led to significant advances in the understanding of human anatomy and physiology.

2) john kay's invention of the "flying shuttle" was instrumental during the industrial revolution because it
a) decreased the need for mechanization.
b) increased the efficiency of steam engines.
) allowed for more food products to be grown.
d) sped the production of textiles and clothing,

Answers

John Kay's invention of the flying shuttle was instrumental during the Industrial Revolution because it sped up textile production, increased efficiency, and laid the foundation for further mechanization in the industry.

John Kay's invention of the "flying shuttle" played a crucial role in the Industrial Revolution by significantly speeding up textile production.

The "flying shuttle" was a significant innovation in the textile industry during the Industrial Revolution. It was a mechanical device designed to weave cloth more efficiently.

By enabling weavers to work faster and weave wider fabrics, the flying shuttle greatly increased the speed of textile production.

The invention had a transformative impact on the textile industry by allowing for the production of larger quantities of cloth in a shorter amount of time. This increased productivity played a vital role in fueling the growth of the Industrial Revolution, as it met the rising demand for textiles and clothing during that time.

The flying shuttle's increased efficiency led to greater mechanization in the textile industry. It allowed weavers to produce wider fabrics, which required larger looms and led to the development of more advanced machinery.

The invention paved the way for further technological advancements in the textile industry, such as the power loom and spinning machines, which ultimately revolutionized the production process.

Learn more about Industrial Revolution here :

https://brainly.com/question/32339363

#SPJ11

Pretend you are a a citizen of Austro-Hungary and you are explaining to your family members in another country why the war has started. Be sure to cite three reasons/causes for the war, and explain those reasons with accurate historical details.





End the letter, with your ideas on how war could have been avoided

Answers

By considering all the given situation the letter with all the details and explanation is as follow -

Dear Family,

I wanted to write to you and explain why the war has started here in Austro-Hungary. It is a complex situation with multiple causes, but I will try my best to provide you with a clear understanding.

Firstly, one of the main causes of the war is the assassination of Archduke Franz Ferdinand, the heir to the Austro-Hungarian throne. His assassination in Sarajevo by a Bosnian Serb nationalist triggered a chain of events that led to the outbreak of war. This event heightened existing tensions between different ethnic groups within the Austro-Hungarian Empire.

Secondly, the system of alliances among European powers played a significant role. When Austria-Hungary declared war on Serbia in response to the assassination, it set off a domino effect. Serbia's ally, Russia, came to its defense, leading to a clash between Russia and Austria-Hungary. This, in turn, drew other nations into the conflict, including Germany, France, and Britain.

Lastly, underlying economic and imperial rivalries contributed to the war. European powers were competing for colonies and resources, which created a climate of tension and rivalry. The arms race, particularly between Germany and Britain, further escalated tensions and heightened the chances of conflict.

In my opinion, the war could have been avoided if diplomatic negotiations had been prioritized over military action. If countries had been willing to engage in dialogue, find peaceful resolutions, and address the underlying issues, the war might have been averted. It is essential for nations to maintain open lines of communication and work towards mutual understanding to prevent such catastrophic events from occurring.

Please take care, and I look forward to hearing from you soon.

With love,

[Your Name]

Learn more about catastrophic events

https://brainly.com/question/21628422

#SPJ11

1. How did the United States supply the people and weapons to fight the war?

2. How did the Allies defeat Germany and Italy?

3. How did the United States defeat Japan?

4. What social and economic changes arose from the war?

5. Do you see any similarities between how the Japanese Americans were treated then and how other ethnic groups are treated today in America? Explain.

Answers

1. The US. supplied its military with a combination of conscription and voluntary enlistment.

2. The Allies defeated them through strategic bombing, ground offensives and naval operations.

3. The United States defeated Japan through strategic bombing, naval operations and ground offensives.

How did the United States supply the people and weapons to fight the war?

During World War II, they relied on a combination of conscription and voluntary enlistment to supply its military personnel. The Selective Service System was responsible for drafting young men into service and others volunteered for military duty.

The country ramped up industrial production of weapons and supplies, with the government awarding contracts to private companies to produce everything from rifles to tanks. The government also encouraged citizens to contribute to the war effort through the purchase of war bonds and rationing of goods like gasoline and food.

Read more about WWI

brainly.com/question/446364

#SPJ1

Which of these is the main idea of the Social Gospel Movement?

Answers

Answer:

A. Speak out against injustices in the world.

Explanation:

Do people behave well and refrain from hurting others or committing crimes only because


they are afraid of getting caught?

Answers

No, people do not behave well and refrain from hurting others or committing crimes solely because they are afraid of getting caught.

While the fear of consequences and punishment can be a deterrent for some individuals, there are various other factors that influence human behavior and promote positive actions.

Ethics and Morality: Many people have internalized ethical and moral values that guide their behavior. They understand the difference between right and wrong and choose to act in accordance with their moral compass, even in the absence of external monitoring or punishment.

Empathy and Compassion: Humans have the capacity for empathy and compassion, which enables them to understand and share the feelings of others. This empathy often leads individuals to consider the well-being of others and refrain from causing harm.

Social Norms and Expectations: Society establishes norms and expectations for behavior, which influence individuals to conform and act in ways that are considered socially acceptable. The desire to fit in, gain approval, and maintain positive relationships can motivate people to behave well.

Personal Values and Integrity: Individuals may have personal values and a sense of integrity that guides their actions. They may prioritize honesty, fairness, and respect in their interactions with others, regardless of external consequences.

Education and Upbringing: Education and upbringing play a crucial role in shaping behavior. The values instilled through education, family, and community can shape individuals' moral compass, fostering a sense of responsibility and respect for others.

While fear of consequences can be a factor in deterring certain individuals from engaging in harmful behavior, it is important to recognize that human behavior is influenced by a combination of factors, including personal values, social norms, empathy, and a sense of moral obligation. Society relies on a combination of deterrence, education, and fostering positive values to promote a culture of ethical behavior and discourage harmful actions.

Learn more about empathy here:

https://brainly.com/question/28258799

#SPJ11

give a historical example of a group whose reproductive success was amplified by war

Answers

Answer:

United States WW2 1941

Explanation:

During and after the war they had a major finical boom that drug them out of the great depression because the war almost completely eliminated unemployment issues.

One historical example of a group whose reproductive success was amplified by war is the Mongol Empire. The Mongols were a nomadic people who relied heavily on their horses and were skilled warriors.

They conquered a vast territory during the 13th and 14th centuries, which allowed them to gain access to new resources and expand their population.

However, the Mongols also engaged in brutal warfare that often resulted in the killing of many enemy soldiers and civilians. This violence allowed the Mongols to weaken their enemies and gain control over their territories.

Additionally, the Mongols took many women as spoils of war, which allowed them to increase their reproductive success.

These women were often integrated into Mongol society, where they would have children who would contribute to the growth of the empire.

Overall, the Mongol Empire's military conquests were a significant factor in amplifying their reproductive success.

To know more about Mongol Empire refer here:

https://brainly.com/question/12783532#

#SPJ11

An aqueous solution of magnesium chloride and liquid bromine are formed when chlorine gas is bubbled through an aqueous solution of magnesium bromide. Identify the reactants and the products. ​

Answers

The reactants in the given chemical reaction are chlorine gas (Cl2) and an aqueous solution of magnesium bromide (MgBr2). The products of the reaction are an aqueous solution of magnesium chloride (MgCl2) and liquid bromine (Br2).

In the reaction, chlorine gas (Cl2) reacts with an aqueous solution of magnesium bromide (MgBr2) to form an aqueous solution of magnesium chloride (MgCl2) and liquid bromine (Br2). The reaction can be represented by the following balanced chemical equation:

Cl2 + MgBr2 → MgCl2 + Br2

Chlorine gas (Cl2) is a strong oxidizing agent, and it reacts with magnesium bromide (MgBr2) in an aqueous solution. The chlorine gas oxidizes the bromide ion (Br-) to form bromine (Br2), which is a liquid at room temperature. At the same time, magnesium (Mg2+) from magnesium bromide combines with chlorine to form magnesium chloride (MgCl2), which remains in the aqueous solution.

The reaction is a displacement reaction, where chlorine replaces bromine in the compound. This type of reaction occurs when a more reactive element displaces a less reactive element in a compound. In this case, chlorine is more reactive than bromine, leading to the formation of magnesium chloride and bromine as the products of the reaction.

Learn more about chemical equation here:

https://brainly.com/question/28792948

#SPJ11

Read this excerpt from The Miracle Worker Act 2.



(She drops her eyes to spell into HELEN’S hand, again indicating the card; HELEN spells back, and ANNIE is amused. )



KATE [TOO QUICKLY]: What did she spell?



ANNIE: I spelled card. She spelled cake!



(She takes in KATE’S quickness and shakes her head, gently. )



No, it’s only a finger game to her, Mrs. Keller. What she has to learn first is that things have names.



KATE: And when will she learn?



ANNIE: Maybe after a million and one words.



(They hold each other’s gaze; KATE then speaks quietly. )



KATE: I should like to learn those letters, Miss Annie

Answers

In this excerpt from The Miracle Worker Act 2, Annie, the main character, tries to teach Helen Keller the concept of spelling and names. Kate, Helen's mother, is eager to learn the letters herself.

In this scene, Annie engages in a finger game with Helen, attempting to teach her the concept of spelling. However, when Kate asks what Helen spelled, Annie corrects her and explains that Helen spelled "cake" instead of "card." This interaction reveals that Helen is still struggling to understand the connection between objects and their names.

Annie then expresses to Kate that Helen needs to learn that things have names before progressing further. When Kate asks when Helen will learn, Annie responds by saying it may take a significant amount of time, suggesting "maybe after a million and one words."

This exchange highlights the challenges and patience required in teaching Helen Keller, who is deaf and blind, to communicate and understand language. It also showcases Annie's determination and dedication to help Helen overcome these barriers.

Furthermore, Kate's desire to learn the letters herself reflects her commitment to supporting Helen's education and her willingness to actively participate in the process.

Learn more about language here :

https://brainly.com/question/11057236

#SPJ11

all of the following were advocates of women’s rights discussed in the chapter except: group of answer choices james otis benjamin rush hannah fayerweather james madison

Answers

The individual who was not an advocate for women's rights as discussed in your chapter is likely Option A. James Otis.

Based on your question, I understand that you're asking about notable advocates of women's rights and which of the provided options did not advocate for women's rights. Here's a brief analysis of each individual:

A. James Otis - He was a prominent lawyer and political activist during the American Revolution. While he made significant contributions to the fight for independence, there is no substantial evidence to suggest he was a strong advocate for women's rights.

B. Benjamin Rush - A founding father of the United States and a physician, he believed in women's education and was a proponent of educational reform. He advocated for women's intellectual development, which can be seen as supporting women's rights indirectly.

C. Hannah Fayerweather - She was an African-American abolitionist and women's rights activist during the 19th century. Hannah was a member of the Philadelphia Female Anti-Slavery Society, which demonstrates her commitment to advocating for women's rights.

D. James Madison - The fourth President of the United States and a key architect of the U.S. Constitution. While he contributed significantly to the development of the country, he did not specifically focus on women's rights in his work.

Based on this analysis, the individual who was not an advocate for women's rights as discussed in your chapter is likely James Otis. Therefore, the correct option is A.

The question was incomplete, Find the full content below:

all of the following were advocates of women’s rights discussed in the chapter except: group of answer choices

A. James Otis

B. benjamin rush

C. hannah fayer weather

D. james madison

Know more about Women's rights here:

https://brainly.com/question/29889364

#SPJ11

Based on the sources and your knowledge of social studies, explain how the Quakers and the Puritans contributed to the development of the English colonies in North America

Answers

The Quakers and the Puritans made significant contributions to the development of the English colonies in North America.

The Quakers, also known as the Religious Society of Friends, played a crucial role in the establishment of Pennsylvania. Led by William Penn, the Quakers sought religious freedom and equality. They promoted principles such as peace, tolerance, and social justice, which influenced the development of a diverse and inclusive society in Pennsylvania. The Quakers established fair and just relations with Native American tribes and implemented progressive policies such as religious freedom and democratic governance.

On the other hand, the Puritans, who settled primarily in New England, had a profound impact on the social, political, and religious development of the colonies. Seeking to purify the Church of England from within, the Puritans established strict religious communities characterized by strong religious convictions, moral discipline, and a strong work ethic. They emphasized education and established schools and universities, such as Harvard, which contributed to the intellectual and educational growth of the colonies. The Puritans' strong sense of community and commitment to their religious beliefs influenced the development of self-governing towns and the establishment of democratic institutions.

Overall, both the Quakers and the Puritans played significant roles in shaping the English colonies in North America, leaving lasting legacies in terms of religious freedom, democratic ideals, educational institutions, and societal values.

Learn more about Quakers

https://brainly.com/question/833046

#SPJ11

3. how did the elections change the balance of power in the senate? which party now selects the senate majority leader and all the senate committee chairs? there was

Answers

The outcome of elections can significantly alter the balance of power in the Senate. The party that gains a majority of seats in the Senate will have the authority to select the Senate majority leader and control the appointment of all Senate committee chairs.

Elections play a crucial role in determining the balance of power in the Senate. When a party wins a majority of seats in the Senate, it gains control over the legislative agenda and decision-making processes. As a result, the party with the majority can select the Senate majority leader, who serves as the spokesperson and chief strategist for the party in the Senate.

The majority party also has the authority to appoint committee chairs, who hold significant power in shaping legislation and overseeing specific policy areas.

The party that becomes the majority in the Senate following elections gains significant control over the legislative process. They have the ability to advance their policy agenda, set the Senate's priorities, and control the flow of legislation.

The majority party's selection of the Senate majority leader and committee chairs allows them to exercise influence over the committee system and determine which bills receive consideration and how they are shaped.

In summary, elections have a direct impact on the balance of power in the Senate. The party that secures a majority of seats gains the authority to select the Senate majority leader and appoint committee chairs, enabling them to shape the legislative agenda and exercise significant influence over the policy-making process.

Learn more about policy agenda here :

https://brainly.com/question/11473719

#SPJ11

District courts hear original _ and _ cases that are tried by juries

Answers

District courts hear original civil and criminal cases that are tried by juries.

District courts are the trial courts of the federal judiciary system in the United States. They have the authority to hear a wide range of cases, including both civil and criminal matters. When it comes to civil cases, district courts have jurisdiction over cases involving federal laws, disputes between parties from different states, and cases involving large sums of money. They also handle criminal cases involving violations of federal laws, such as drug trafficking, fraud, and other federal offenses. In both civil and criminal cases, district courts provide a forum for these cases to be tried by a jury, where a group of individuals from the community decides the outcome based on the evidence presented.

Learn more about criminal cases here:

https://brainly.com/question/13391617

#SPJ11

Other Questions
In ____________________ connections, your computer dials up and connects to your ISP's computer only when needed.A. AepanetB. BroadbandC. Dial-upD. Bandwidth cheng is making a trip to her safe deposit box. what is she most likely planning to do?group of answer choices suppose the population of bears in a national park grows according to the logistic differentialdp/dt = 5P - 0.002P^2where P is the number of bears at time r in years. If P(O)-100, find lim Po) A study of blood pressure and age compares the blood pressures of men in three age groups: less than 30 years, 30 to 55 years, and over 55 years. Select the best method to analyze the data. a. Wilcoxon rank sum test b. Mann-Whitney test c. Kruskal-Wallis test d. Wilcoxon signed rank test Suppose that you borrow $10,000 on a 60-month car loan at 6.25% APR. Compute the monthly payment. a. Set up an equation for the problem using the following variables: n i pv pmt fv; where n=number of periods and i= interest rate per periodWhat is the actual formula?Does this one work? Part of a homeowner's insurance policy covers one miscellaneous loss per year, which is known to have a 10% chance of occurring. If there is a miscellaneous loss, the probability is c/x that the loss amount is $100x, for x = 1, 2, ...,5, where c is a constant. These are the only loss amounts possible. If the deductible for a miscellaneous loss is $200, determine the net premium for this part of the policythat is, the amount that the insurance company must charge to break even. if the enzyme-catalyzed reaction e s es e p is proceeding at or near the vmax of e, what can be deduced about the relative concentrations of s and es What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history? Using the article "You Trouble" discuss whether or not stunt videos cause teens to take risks and increase impulsive behavior consider the given state of stress. take a = 21 mpa and b = 45 mpa. determine the principal planes. the principal planes are at and .Determine the principal planes using Mohr's circle. a) The principal planes are at and .Determine the principal stresses using Mohr's circle. b)The minimum principal stress is MPa, and the maximum principal stress is MPa.Determine the orientation of the planes of maximum in-plane shearing stress using Mohr's circle. c) The orientation of the plane of maximum in-plane shearing stress in the first quadrant is . The orientation of the plane of maximum in-plane shearing stress in the second quadrant is .Determine the maximum in-plane shearing stress using Mohr's circle. d) The maximum in-plane shearing stress is MPa.Determine the normal stress using Mohr's circle. e)The normal stress is MPa. What are the three key components of the production process? machines, equipment, and tools purchasing, sales, and distribution testing, quality assurance, and compliancematerials, machines, and people let a2 = a. prove that either a is singular or det(a) = 1 relative to the current dsm-iv system of classifying mental disorders, the five-factor model suggests question Q#6 If a roan bull is crossed with a white cow, what percent of offspring will have a roan phenotype? 100% 753 25 SON Question 7 Q#7 Both Mrs. Smith and Mrs Jones had baby girls the same day in the same hospital. Mrs. Smith took home a baby girl, who she ca Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect however, that her child and the Smith baby had accidentally switched in the nursery. Blood tests were made. Mr. Smith is Type A Mes Smith is Type B. Mr. Jones is Type A Mestone Type A. Shirley is Type O, and Jane is Type B. Had a mix-up occurred, or is it impossible to tell with the given information it is impossible to tell with the oven Information Alkup occured. The Smiths could not have had a bay with type o blood Amb up occured. The Jones could not have had a baby with Type B blood Amik up occured. Neither parents could have produced a baby with the stated blood type Question 8 Gomovies.com Q8 If a man of genotype i marries a woman of genotype what possible blood types could their children have their children could have A Bor AB blood types their children could have A st As blood types their children could have A B. ABor blood types the children could have A or blood tyres Search O 31 Question 2 of 10Which question would be most appropriate to ask yourself when consideringhow to address your audience for a procedural document?OA. What research do I need to do to understand my topic?B. Will readers respond best to a formal or informal style?OC. Why can't I find a good image to illustrate my points?OD. Where can I go for information about my topic?WSUBMIT