The length of a picture frame is inches more than the width. For what values of x is the perimeter of the picture frame greater than ​inches?

The Length Of A Picture Frame Is Inches More Than The Width. For What Values Of X Is The Perimeter Of

Answers

Answer 1

9514 1404 393

Answer:

  x > 35

Step-by-step explanation:

The perimeter is twice the sum of length and width. You want x such that ...

  P > 156

  2(x +(x+8)) > 156

  4x +16 > 156 . . . . . simplify

  x +4 > 39 . . . . . . . . divide by 4

  x > 35 . . . . . . . . . . . subtract 4

The perimeter of the frame will be greater than 156 inches for x > 35.


Related Questions

If 25% of an item is 20$, what is the original price?
I will give Brainliest
ASAP!!!

Answers

Answer:

I think that the original price would be $30, but I'm not completely sure.

Step-by-step explanation:

Half (50%) of 40 would be 20, and half of 20 (25%) would be 10. Add 10 to 20 to get 30, because you are adding the %25 back to $20.

Hope this helps!

Answer:

$80

Step-by-step explanation:

25% = 1/4

To get original price multiply by 4:

$20 × 4 = $80

A quadratic function is represented by the graph. (graph below.) (do a-d.)

(a) What is the equation of the axis of symmetry of the function?
(b) What are the coordinates of the vertex of the function?
(c) What are the coordinates of the x-intercepts of the function?
(d) What are the coordinates of the y-intercept of the function?

Answers

Answer:

The axis of symmetry is x=1

The vertex is (1,-9)

The x-intercepts are (4,0) and (-2,0)

The y-intercept is (0,-8)

Step-by-step explanation:

axis of symmetry is the line where the vertex is, so in the quadratic of x^2, the axis of symmetry would be zero because half of the equation is on one side and the other half on the other side

The vertex is the lowest point on the quadratic, on the y values

the x-intercepts are the places the graph intercepts the x-axis.

The y-intercepts are the places the graph intercepts the y-axis

ask if u still have any questions!

Of 77 third graders, on Monday 3 were absent from Room 101, 4 were absent from Room 102, and 2 were absent from Room 103. How many third graders attended school that day? ​

Answers

Answer:

68

Step-by-step explanation:

Their are 77 total, 77-3= 74-4= 70-2= 68

there are 68 3rd graders left

Do 9-77

Can someone please help? I will mark brainliest random answers will be reported

Answers

Answer:

5.1

Step-by-step explanation:

hope it helps thank you

please help, if u get it I’ll give you brainliest!!
find the area with explanation!

Answers

Answer:

4ft

Step-by-step explanation:

we will use the formula which states area of triangles is equal to base multiplied height divided by 2

base=5ft

height=8ft

area=5*8/2

=13/2

=6.5ft

this pic is not clear pls mention better next time I was confused what is 4ft and what is 8ft however if I have understood wrong I have also written the formula.

Please help me ASAP I’m really confused

Answers

It’s the one on the top left because it’s supposed to be 5.5.5.5.5 and the other one 4.4.4.4

finish the lyrics

a potoao flew

Answers

Around my room before you came.

Answer: around my room before you came

Step-by-step explanation:

What is the equation of the line that passes through the points ( 5,-2) and (-5,0)

Answers

Answer:

y=-1/5x-1

Step-by-step explanation:

Zamir needs to determine the height of the building

What’s the Height “A”
What’s Height “B”
What’s the Height of “X”

PLEASE

Answers

Answer:

Height of the building = 115.4 ft.

Step-by-step explanation:

Height of building = AB + 46.4 + CD + 30.5

By applying Pythagoras theorem in ΔABP,

(26)² = (10)²+ (AB)²

676 - 100 = AB²

AB² = 576

AB = 24 ft

By applying sine rule in ΔCDE,

cos(60°) = [tex]\frac{CD}{CE}[/tex]

CD = CE × [tex]\frac{1}{2}[/tex]

CD = [tex]\frac{29}{2}[/tex]

CD = 14.5 ft

Total Height = 24 + 46.4 + 14.5 + 30.5

                     = 115.4 ft

Q1.) Morgan buys 3 pairs of socks for $1.29 each and a pair of shoes for $29.95. The sales tax is 8 %.
What is the total amount she spends including tax?

Answers

Answer:

She spends $36.53

Stephanie can jump rope 12o turns in 3 minutes. How many turns does she make in 1 minute

Answers

She would be able to make 40 in one minute.

To find this, you just divide 120/3 to find how many in one minute.

Answer:

40

Step-by-step explanation:

120 divided by three equals fourty

If 25% of the whole school (630 students) got to go on the trip, how many
students is that? help i’m gone fail idc how easy this is

Answers

Answer:

157 Students go on the trip

Step-by-step explanation

630 x .25

= 157.5

Answer:

Perceentage of whole students= 25%

Students= 630

630 X 25

157.50

Hope it helps

Michael's class held a food drive for the holidays. There are a total of 29 students in his class. On average, each boy and girl bought 3 cans of food apiece. If the class brought in a total of 87 cans of food, how many boys and how many girls are in the class ?

Answers

Answer:

19 girls snd 10 boys

SOMEONE PLEASE HELP ME I WILL GIVE BRAINLIST TO THE PERSON WHO GIVES ME THE CORRECT ANSWER

Three shipping companies want to compare the mean numbers of deliveries their drivers complete in a day.

The first two shipping companies provided their data from a sample of drivers in a table.

Company C showed its data in a dot plot.


Answer the questions to compare the mean number of deliveries for the three companies.





1. How many drivers did company C use in its sample?


Write your answer in the space below.









2. What is the MAD for company C's data? Show your work.


Write your answer in the space below.









3. Which company had the greatest mean number of deliveries?


Write your answer in the space below.









4. Compare the means for companies A and B. By how many times the MAD do their means differ? Show your work.


Write your answer in the space below.

Answers

Answer:

Step-by-step explanation:

1. 10

2.The mean is ten because 6 + 7 + 8 + 9 + 10 + 10 + 10 + 12 + 14 + 14 = 100/10. The (Mean) = 10

3. is A and B

Thats all i have still stuck on number 4 sorry

The proper angle for a ladder is about 75 from the ground. Suppose you have a 6 foot ladder. How high
can it reach?
ht

Answers

Answer:

450

Step-by-step explanation:

75 x 6 is 450 so the answer is 450

John can read 20 pages in 6 minutes. At this rate, how many pages can he read in 1 hours?

Answers

Answer= 250 pagess

Step by step explanation

Answer:

200

Step-by-step explanation:

just do 6 times 10 because that will get you 60 min (1 hour)

then just do 10 x 20 as well for the pages

What is the value of the expression when a = -5 and c =-1? Enter your answer in the box.​

Answers

-5 is the answer your welcome

hi please help with my maths!

Answers

Answer: I need more to solve this

Step-by-step explanation:

Answer:

AB equals 4.535 (4.53478)

Find X pls thanks so much

Answers

Answer: X= 16.83 or 17 rounded

Step-by-step explanation:

Sin63 degrees= 15/x so to solve for x divide 15 by sin 63

[tex]\frac{15}{sin63}[/tex]=16.83

Which of the following shows the least expensive unit price?

Answers

it would be the first one because each orange costs $0.34

Answer:

A (3 Oranges For $1.02)

Step-by-step explanation:

3 Oranges for $1.02 is $0.34 for each Orange

4 Oranges For $1.52 is $0.38 for each Orange

6 Oranges for $2.46 is $0.41 for each Orange

5 Oranges for $1.75 is $0.35 for each Orange

Which Makes The First One The Cheapest Out Of All

NEED ASAP!!!

Find the area of the composite figure.


Answers

The area is 14 because the triangles area is 6 and the rectangles area is 8

Find the value of x
A. 6
B. 9
C. 15
D. 3
Plz help I may mark Brainiest

Answers

Answer:

A. 6

Step-by-step explanation:

[tex]10x \degree + 30 \degree = 90 \degree \\(complementary \:angles) \\\\ 10x \degree = 90 \degree - 30 \degree\\ \\ 10x \degree = 60 \degree \\ \\ 10x = 60 \\ \\ x = \frac{60}{10} \\ \\ x = 6[/tex]

Evaluate the following expression. log4 256
A. 64
B. 16 C. 4 D. 8

Answers

The correct answer is c.4

The simplified value of the expression  [tex]log_4[/tex] 256 is 4.

Thus, option (C) is correct.

To evaluate the expression [tex]log_4[/tex] 256, determine the power to which 4 must be raised to obtain 256.

So, the equation can be set up

[tex]4^x[/tex] = 256.

Now, put the value of x one by one as

[tex]4^2 = 16[/tex]

[tex]4^3 = 64[/tex]

[tex]4^4 = 256[/tex]

Thus, when the number 4 raise to the power 4 it gives 256.

Thus, option (C) is correct.

Learn more about Exponents here:

https://brainly.com/question/5497425

#SPJ6

The half-life of the isotope Osmium-183 is 12 hours. Choose the equation below that gives the remaining mass of Osmium-183 in grams, M.
after n half-lives have elapsed if there was an initial mass of 590 grams before decay. Then, use the equation to determine the mass remaining
after 36 hours have passed
Mn = 590. ()": M3 – 148
D
M, = 590 C4)*-* : My ~ 148
Mn = 590 - ()": Mz - 74
Mi = 590 - (1) * + : Mz - 74

Answers

The given equations are incomprehensible, I'm afraid...

You're given that osmium-183 has a half-life of 12 hours, so for some initial mass M₀, the mass after 12 hours is half that:

1/2 M₀ = M₀ exp(12k)

for some decay constant k. Solve for this k :

1/2 = exp(12k)

ln(1/2) = 12k

k = 1/12 ln(1/2) = - ln(2)/12

Now for some starting mass M₀, the mass M remaining after time t is given by

M = M₀ exp(kt )

So if M₀ = 590 g and t = 36 h, plugging these into the equation with the previously determined value of k gives

M = 590 exp(36k) = 73.75

so 73.75 ≈ 74 g of Os-183 are left.

Alternatively, notice that the given time period of 36 hours is simply 3 times the half-life of 12 hours, so 1/2³ = 1/8 of the starting amount of Os-183 is left:

590/8 = 73.75 ≈ 74

Mount Whitney, is the highest point in California. It sits at 14,494 feet above sea level. The lowest point in California is Death Valley, which is 282 feet below sea level. What is the DIFFERENCE between the two points? ITS TIMED!!

Answers

Answer:

14,776 feet

Step-by-step explanation:

for a cube with side length 4cm, calculate the surface area

Answers

Answer: I believe that’s 96 squared cm

Step-by-step explanation:

The formula for surface area for a cube is 6 times the side to the power of 2

6*4^2 = 96 cm^2

1. y-23=55 2. x-14= -8




3. -15 = n + 18 4. 18.3 + a = 2.7
what are the answers for all of these i need help FAST!!!

Answers

Answer:

1. y = 32

2. x = 6

3. -33 = n

4. a = -15.6

Step-by-step explanation:

1.

y-23=55

 +23  +23          (23 cancels)

y = 32

2.

x - 14 = -8

 +14      +14           (-14 cancels)

   x = 6

3.

-15 = n + 18

    -18       -18          (18 cancels)

    -33 = n

4.

18.3 + a = 2.7

-18.3        -18.3        (18.3 cancels)

         a = -15.6

help me with this thanks

Answers

Answer:

hiii

Step-by-step explanation:

Answer:

Answer is B

Step-by-step explanation:

Front view is the same as viewing from the side, and on top it just looks like a square

Hope I helped

Help asap pls for brainliest!

Answers

Answer:

D

Step-by-step explanation:

Answer:

D

Bro this is the answer!

^>…~|-+First Answer Gets Brainliest+-|~…<^
Question Is in the picture!

Answers

Answer: ten times 3 x ^2

Step-by-step explanation:

Answer:

Substitute 10 for x in the equation. [tex]3(10)^2[/tex]. If that is not a choice for the answer then you would multiply 10 by the second power.

[tex]3(10)^2\\3(100)[/tex]

Step-by-step explanation:

I hope this helps! May i please have brainliest? :)

Other Questions
6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks. hey can someone give me an idea how I should do a rough draft on a computer What is the range of the function y=-2/3x-10given a domain of{-9,-3,0,3,9}