The average daily volume of urine produced by a normal adult is approximately: A. 200 mL. B. 500 mL. C. 1200 mL. D. 2500 mL

Answers

Answer 1

The average daily volume of urine produced by a normal adult is approximately 1200 mL or option C. However, this volume can vary depending on several factors, including fluid intake, diet, activity level, and overall health.

In general, a person should produce at least 400 to 600 mL of urine per day to adequately eliminate waste products from the body. Anything less than this can be a sign of dehydration or other health issues.
The kidneys play a vital role in regulating the amount of urine produced by the body. They filter waste products and excess fluids from the bloodstream, which are then eliminated as urine. Urine production can also be influenced by hormones such as antidiuretic hormone (ADH), which helps the body conserve water by reducing urine output.
If you have concerns about your urine output or notice a significant change in the volume or color of your urine, it is important to speak with your healthcare provider. They can perform tests to evaluate your kidney function and rule out any underlying health conditions.

learn more about health

https://brainly.com/question/13589681

#SPJ11


Related Questions

the carbon cycle review of terms

Answers

Answer:

A solid line would represent point on the graph that actually are included in the solution, while points that lie on dash lines aren't included in the solution.

The carbon cycle takes place in the environment, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

What is the carbon cycle?

The carbon cycle is important for the environment because carbon is present in the animal cell, in food, etc., and the carbon cycle is present in the given diagram. Here, the plant takes in the atmospheric carbon dioxide shown in the arrow 1, and the carbon dioxide is released by the animals and plants shown in the arrow 2.

Arrow 3 explains the rabbit taking the carbon from the food source, the plant releases oxygen and arrow 4 explains the carbon released by the decomposers from the animals and plants; and arrow 5 shows the carbon converted into fossil fuels. Arrows 6 and 7 both explain the release of carbon dioxide while plants use it for food synthesis.

Hence, the carbon cycle takes place in the atmosphere, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

Learn more about the carbon cycle here.

https://brainly.com/question/1627609

#SPJ2

A mRNA codon is AGC. The tRNA anticodon will be

Answers

YES YES YES YES YES YES YES YES I don’t get what u are saying but points for me!
A mRNA codon is AGC. The tRNA anticodon will be UCG.

A student knows the width and
length of a dresser. What else
should she measure so she can
calculate the volume?
A. Mass
B. Density
C. Height

Answers

Answer:

C. Height

Explanation:

The volume of a rectangle is Length x width x height.

The student has only measured the width and length so far, the only thing left to measure is the height.

The other answers don't make sense.

Hope this helps!!

- Kay :)

Answer:

c

Explanation:

Match each description with the correct ecosystem.

This ecosystem experiences sudden changes in water level and temperature.

This ecosystem contains a mix of fresh water and salt water.

This ecosystem supports many plants, which provide food for schools of fish.

Answers

Answer:

1 - B or intertidal zone

2 - A or estuary

3 - C or neritic zone

Explanation:

These are the correct answers, I took the test on edge, have a great day!!

Answer: B, A, C,

Explanation:

I did it and got it right

What is the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers?
A) Heterotrophs
B) Decomposers
C) Detritivores
D) Autotrophs​

Answers

Answer:

Heterotrophs

Explanation:

A heterotroph is an organism that eats other plants or animals for energy and nutrients.

The correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

What are heterotrophs?

Heterotrophs are organisms which cannot produce their own food but rather depend on other organisms for its food.

Heterotrophs consume other organisms such as plants and other animals for the production of energy.

Therefore, the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

Learn more about heterotrophs at: https://brainly.com/question/4933024

Which of the following statements is FALSE?
A. RNA is a single stranded molecule
B. RNA contains uracil
C. RNA is found only in the cytoplasm.
D. RNA contains ribose

Answers

Answer:

C

Explanation:

RNA is found mostly in the nucleus but can also be found in the cytoplasm, but it is not limited to it.

Phineas and Ferb build a flying machine. They accelerate into the air in a
straight line, going from 0 m/s to 30 m/s in 3 s. Find their average
acceleration.

Answers

10

30 dived by 3 = 10

hope it helps

match the choices with each box.

Answers

Answer:

1 is totipotent

2 is mutipotent

3 is pluripotent

4 is totipotent

5 is pluripotent

6 is mutipotent

Explanation:

I honestly dont know sorry if they r wrong

What is the structure of a virus?

Answers

Answer:

The simplest virions consist of two basic components: nucleic acid (single- or double-stranded RNA or DNA) and a protein coat, the capsid, which functions as a shell to protect the viral genome from nucleases and which during infection attaches the virion to specific receptors exposed on the prospective host cell.

A virion consists of a nucleic acid core, an outer protein coating or capsid, and sometimes an outer envelope made of protein and phospholipid membranes derived from the host cell. The capsid is made up of protein subunits called capsomeres. Viruses may also contain additional proteins, such as enzymes

What happens during S phase?

Answers

Answer:

DNA is replicated

The EPA sets national air-quality standards for common air pollutants. The
data table shows the change in concentrations of these pollutants over time.
Emissions Reductions and Air Quality
Data period
Reduction
Pollutant
Improvement
(from/to)
in emissions (%) in air quality (%)
СО
69
85
Pb
99
98
1980 - 2014 NO,
55
60
0,
53
33
81
80
16
30
2000 - 2014
33
36
SO2
PM,
PM25
Which conclusion do the data support?

Answers

The data support the conclusion that reducing emissions leads to improvement in air quality for the common air pollutants monitored by the EPA.

What is EPA?

The Environmental Protection Agency (EPA) is a federal agency of the United States government that was established in 1970 to protect human health and the environment. The EPA's mission is to ensure that all Americans have clean air to breathe, clean water to drink, and safe land to live and work on. The agency is responsible for setting and enforcing national standards for air and water quality, as well as for managing toxic waste and other pollutants.

The EPA also works with other federal agencies, states, tribes, and local governments to address environmental challenges, such as climate change, ozone depletion, and exposure to hazardous substances. The EPA uses a range of tools and programs, including research and development, regulation, partnerships, and education and outreach, to achieve its mission. The agency also provides information and technical assistance to help individuals, communities, and businesses protect the environment and public health.

Learn more about EPA, here:

https://brainly.com/question/30240841

#SPJ1

Answer:

B . With monitoring, the concentration of every pollutant has decreased

Explanation:

When do populations increase?

Answers

Answer:

c

Explanation:

i have seen this before and i got it correct i dont know if it works with you?

hey there!
the correct answer would be C when birth rights are higher then death rights.
this is correct because when there are more people being born and less dying there are more overall people.
hope this helped!

Which of these contributes the most oxygen to our planet?

a. Photosynthetic fungi
b. The Amazon Rain forest
c. the National Forests
d. Phytoplankton

Answers

Answer:

D. Phytoplankton

Explanation:

The majority of this production is from oceanic plankton — drifting plants, algae, and some bacteria that can photosynthesize.

Have a wonderful day! <3

Answer:

D

Explanation:

this is because the ocean produces the most oxygen and most of that comes from plankton in the ocean

What sentence best supports the statement that hormones are involved in the regulation of homeostasis?

A.
The hormone cortisol suppresses the immune system and is produced when the body is under stress.
B.
The hormone oxytocin promotes labor contractions of the uterus during childbirth.
C.
The hormone melatonin induces sleep and its production is slowed by exposure to light.
D.
The hormone erythropoeitin increases the production of red blood cells when oxygen levels are low.

Answers

Answer:

D

Explanation:

It is an homeostatic process

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

Plant life in wetlands is not
different from plant life In other areas.
True
False

Answers

False

Explanation: Plant life in wetlands are moist but in different plant life are not that much moist.

If you wanted to find an ant's stomach, where would
you look?
a. Inside its head
b. Inside its cephalothorax
c. Inside its thorax
d. Inside its abdomen

Answers

Answer:

d. Inside its abdomen

Explanation:

Hope this helps!

D, inside its abdomen


True or False.
A group of the same species of living things in an area is a population

Answers

Answer:

True.

Explanation:

A population is a group of organisms of the same species that live in the same area at the same time

Answer:

True!

Hope this helps.

A student tries to push a refrigerator-sized box of textbooks safely across the classroom.

The box does not move. He asks for help from other students.

The box starts to move when the number of students shown in the image is pushing together.



Based on this information, what conclusion can be drawn?




The box has a mass greater than the combined mass of the first two students pushing.


The forces acting on the box became unbalanced when the third student started pushing.


The only force acting on the box is the push applied by the students.


When the third student started to push, the box’s mass decreased

Answers

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

The horizontal forces, friction and applied, were balanced until more force was applied than friction. Mass can't increase or decrease.

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

What is the difference between your biological sex and your gender identity?

Answers

Answer:

Biological or assigned sex is about biology, anatomy, and chromosomes and Gender is society's set of expectations, standards, and characteristics about how men and women are supposed to act.

Explanation:

Hope this helps!

biological sex is what gender you were born as and what's on your birth certificate. however, a persons gender identity is a persons own choice. it's what you classify yourself as and what you feel comfortable as, despite your biological sex. many people don't even identify as anything or they change their preference of pronouns. gender identity also comes with stereotypes given by the community and what they see fit for genders.

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

Yall Im struggling, if u cant read it, the question is “why does a mountain climber need an oxygen supply at very high altitudes, even tho the air still contains 21% oxygen?

Answers

Answer: Because it is harder to draw breath in. And the cold

Explanation: At higher altitudes, it becomes more dangerous, and you can develop altitude-related illnesses such as HAPE and HACE. I read a book called Into Thin Air, and in the book the author goes into detail on the details/complications of climbing Mt.Everest and oxygen needs. Mountain climbers use canisters of oxygen called Supplemental Oxygen.

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Mitosis is done by your body cells. What types of cells do not undergo mitosis

Answers

Answer:

Sex cells/ gametes

Explanation:

Sperm cells and egg cells don't go through mitosis

Without genetic variation, natural selection would not be possible. Explain why.

Answers

Answer:

Without genetic variation, natural selection is only able to grow the number of allelomorphs that previously exited in the population. Natural selection occurs through an interaction between the environment and the variability of the individual organisms making up a population. If every giraffe had the same neck length, there would be nothing to change and they would never have a long neck by now.

What thing controls the functions of the different cells ? (Hint it is inside the nucleus)

Answers

Answer:

DNA

Explanation:

It's the genetic material that writes up who we are.

But if it's discussing an organelle, then it's the nucleus.

Have a great day!

What change caused the rate of population growth to increase around point C?

Answers

Answer:

point c

Explanation:

Material rising from the mantle reaches the surface at spreading centers.
A. True
B. False

Answers

Yes, It's true!

Explanation:

Material rising from the mantle reaches the surface at spreading centers.

A. True

B. False

HELP ASAP WILL GIVE BRAINLISET Which of the following describes the Cell Theory?

Group of answer choices

(A)All

(B)All living things are composed of one or more cells.

©Cells are the basic unit of life

(D)Cells are produced from existing cells

Answers

Answer:

C. Cells are the basic units of life.

Explanation:

Answer: A.) All
Explanation: Wikipedia :/

Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer: pituitary gland

Other Questions
In either case, the mysterious disappearance of Hohokam civilization seems linked to water, cadillac desert A client who had a cesarean birth of twins 6 hours ago reports shortness of breath and pain in the right calf. What complication should the nurse expect A bond's stated interest rate is ______. (check all that apply. ) Who let mcduff and Lennox into the castle Determine whether the triangles can be proved similar. If they are similar, write a similarity statement. If they are not similar, explain why. A(n) _____ is best defined as a contract that one party may, at its option, either disaffirm or enforce. 30. With regard to exchanges of information between FIUs of different countries, what are three controlling principles Find the equation of the line described.5. Perpendicular to y = 3x + 5; passing through the point (-6,-4) Classify each of the following as a pure substance, homogeneous mixture, solution, or colloid. Often listened to in a car and watched at home, ____ and ____ can be good sources to gather information on Mcmurtry Corporation sells a product for $290 per unit. The product's current sales are 14,000 units and its break-even sales are 10,360 units. The margin of safety as a percentage of sales is closest to:Multiple Choice265te% In operant conditioning studies, the subjects motivational state is most typically operationally defined by:________ the graph to the right depicts the per unit cost curves and demand curve facing a shirt manufacturer in a competitive industry 2.9 Energy levels of electrons (n) indicates the distance of the energy level from the _______ values of n are positive integers n=1 is closest to the nucleus, and________ in energy A student weighs out a 7.24 g sample of , transfers it to a 300. mL volumetric flask, adds enough water to dissolve it and then adds water to the 300. mL tick mark. What is the molarity of zinc chloride in the resulting solutio Even though he was generally responsible, ragin was not very dependable when it came to showing up on time. it is so frustrating to see the total lack of interest and concern our peers have for the recycling program. they couldn't care less. such apathy! jadi could not believe that her sister was training so hard, until she learned that sarah wants to be a triathlete. ted could not decide if he wanted to be a politician or a musician. you bet i'm frugal! i save half my paycheck and spend money very carefully. economy is the name of the game. context clues suffixes A client is admitted with cellulitis and experiences a consequent increase in white blood cell count. during what process will pathogens be engulfed by white blood cells that ingest foreign particles? The length of a rectangle is two feet greater than twice its width. If the perimeter is 25 feet, find the width. Which of the following translations is correct Coffee King Starbucks Raises Its Prices Blame the sour news at Starbucks this week on soaring milk cost. The wholesale price of milk is up nearly 70% in the 12 months. Theres a lot of milk in those [Starbucks] lattes, notes John Glass, CIBC World Markets restaurant analyst. USA Today, July 24, 2007 a. Is milk a fixed factor of production or a variable factor of production? b. Describe how the increase in the price of milk changes Starbuckss short run cost curve. What is the area of the trapezoid below?