Marfan syndrome is caused by a defect in FBN1 gene located on chromosome 15. The gene normally encodes the fibrilllin-1, which is important for the elasticity and appropriate growth of connective tissue. The defect in the gene that causes Marfan syndrome results in a decrease in the amount of functional fibrillin-1 produced. One defective copy of the gene is sufficient to cause Marfan syndrome.

Answers

Answer 1

Marfan syndrome is an autosomal dominant condition.

What is Marfan Syndrome?

Connective tissue, or the fibers that support and anchor your organs and other body components, is harmed by Marfan syndrome, a genetic disorder. Most frequently, the heart, eyes, blood arteries, and skeleton are impacted by Marfan syndrome.

It happens because one healthy copy of the FBN1 gene is not sufficient to sustain the normal development of connective tissue.

To learn more about Marfan syndrome with the help of the given link:

https://brainly.com/question/10884538

#SPJ4


Related Questions

Which explanation describes why males are more likely to exhibit sex-linked disorders than females?

Answers

A male with a mutation in a gene on the X chromosome is typically affected with the condition. Because females have two copies of the X chromosome and males have only one X chromosome, X-linked recessive diseases are more common among males than females.

PLS HELP IM TIMED!!
Fish eggs that are fertilized externally are typically clustered and covered in a thick, jelly-like substance.
What is most likely the function of this substance?
a) to protect the eggs and keep them consistently warm inside the parent's body
b) to protect the eggs and keep them safe from any harmful environmental conditions
c) to ensure that only a few of the eggs are fertilized by sperm since external fertilization is uncommon and risky
d) to ensure that only some of the eggs are fertilized by sperm so others can be fertilized internally

Answers

Answer:

Don't get me wrong but I think it's B

Explanation:

Answer:

The correct answer is B: to protect the eggs and keep them consistently warm inside the parent's body.      It is correct on edge

Explanation:

Hope this helps and good luck:)

2. What can you infer from the fact that ants make up
20 percent of the mass of all land animals combined?
a. Ants are very heavy
b. Ants live for a long time
c. Ants thrive in locations all over the world
d. Ants breed faster than any other organism on earth

Answers

D, because they are not heavy, so if they form 20 percent of the mass of all land animals combined it means that there are many ants in the world due to the fast breed

Ant breed faster than any other organism on earth, 20% of earth mass have land animals. Many ants are on the earth. Thus, option D is correct.  

What are the major features of ants ?

Ants belongs to Formicide family  which is related to so called eusocial insects like bees and termites. It is appeared in the Cretaceous period that is more than 90 million years ago.

The diversity of ants is every where except Antarctica.

The body has three parts such as  a head, a meso-some and metasoma or gaster.

Ants are mostly omnivorous but can be scavengers , predators or herbivores based on ecological context.

The reproduction in which young, queens  fly during mating time, fertilize with male, this flight is called as nuptial flight.

Then queen lay eggs, then larvae emerge to become pupae, then adults such as workers, soldiers, males or other queens are produced.

Thus, option D is correct.  

Learn more about ants, here:

https://brainly.com/question/932986

#SPJ2

What percent of the energy from an organism is passed to the organism that eats it?
10%
25%
100%
1%

Answers

10%

Explanation:

im sorry if im wrong but from what i learned thats the percentage

Answer:

10%

Explanation:

What cell structures are made in G1?

Answers

Answer:

Organelles

Explanation:

How do you think about the invention of the microscope? Influenced the cell theory?
And what are the components of the cell theory?

Answers

Answer:

See the answer below

Explanation:

The invention of the microscope paved way for the development of the cell theory because, without it, the cell and all the organelles of the cell would not have been discovered and or studied in great detail. It was through the use of  a microscope that Robert Hooke was able to observe and name the cell and it was through the same microscope that the fine details of the cell were able to be studied by other scientists, culminating in the formulation of the cell theory.

The cell theory states that all living organisms are made up of cells, the cell is the basic unit of all life, and cells can only arise from already existing cells (via cell division). The components of the cell theory, therefore, are:

Living organisms are made up of cells.The cell represents the basic unit of life.Cells can only arise from preexsiting cells.

My teacher is bugging me to answer this question help ​

Answers

Allie should wear sunscreen to protect herself from skin cancer and maintain a healthy lifestyle and mindset, these could help in the long run! Hope this helped!

Anyone know what is the answer pls ?

Answers

Answer:

1. Viruses 2. ? 3. Viruses 4. ? 5. Immunity 6. Vaccine

Explanation:

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

Procedure
1
2.
3
Place a strawberry in a zip-closure
bag and remove most of the air
before you seal the bag.
Add 2 tablespoons of the DNA
extracting solution
Mash the strawberry through
the bag in your hand. Do not hit
against the table as this might
damage the DNA
4
5
6
Continue mixing and mashing the
bag in your hand.
Place a piece of gauze over the
opening of the cup, securing it
with a rubber band.
Carefully pour the strawberry
mixture into the cup making sure
to catch the solids with the gauze.
7
8
9
27
Take a dropper or spoonful of the
liquid in the cup and place in the
test tube.
Add a dropper for spoonful of the
alcohol to the test tube. Take care
not to tilt or tip the test tube; do
not mix the two liquids.
Observe the line between the
strawberry mixture and the
alcohol.
Explain each step of the process,and the science behind why those steps needs to be completed. Please help I'll give you brainlest

Answers

dude i’m sorry, but you should just do the lab it’ll take you like 10 minutes

What is lapse rate with respect to the atmosphere?

Answers

Answer:

The term is almost always used with respect to temperature but is occasionally used for other variables.

Explanation:

someone already answered you, ima just type because i need points sorry

why are viruses not regarded as true living cells?​

Answers

Explanation:

Most biologists say no. Viruses are not made out of cells, they can't keep themselves in a stable state, they don't grow, and they can't make their own energy. Even though they definitely replicate and adapt to their environment, viruses are more like androids than real living organisms.

Viruses are not comprised of cells, they cannot maintain a stable internal environment, they cannot reproduce, and they cannot produce their own energy.

What is environment?

Environment is defined as a compilation of all the factors living and nonliving and the outcomes they have on human life. Due to their ties to the forest, its plants, wildlife, water, and air. The air is filtered and hazardous gases are absorbed by the forest and trees. Plants filter water, lessen the likelihood of flooding, preserve the natural equilibrium, and do many other things.

Viruses are more like robots than actual living things, even though they do replicate and adapt to their surroundings. The viruses are thought to be dead in their natural habitat since they lack any cell-like properties. However, inside the host cell, the viruses employ the host's technological infrastructure to carry out all necessary tasks including reproduction.

Thus, viruses are not comprised of cells, they cannot maintain a stable internal environment, they cannot reproduce, and they cannot produce their own energy.

To learn more about environment, refer to the link below:

https://brainly.com/question/13107711

#SPJ6

Help!! Please!! I'll name you brainliest!!

Answers

Explanation:

the same as the charge on the ion.+1 +2-2

5. -1

plz mark my answer as brainlist plzzzz you get it helpful ☺️.

Hope this will be helpful to you.

1. What were the conditions on the planet when life began?

Answers

Answer: The early Earth had no ozone layer and was probably very hot. The early Earth also had no free oxygen. Without an oxygen atmosphere very few things could live on Earth. Anaerobic bacteria were probably the first living things on Earth.

primates evolved during what era ​

Answers

The beginning of the Eocene Epoch Era.

Project: Earths layers

Answers

Answer:

here hope helps

Explanation:

what are the advantages of anaerobic respiration and aerobic respiration?

Answers


Aerobic and anaerobic respiration each have advantages under specific conditions. Aerobic respiration produces far more ATP, but risks exposure to oxygen toxicity. Anaerobic respiration is less energy-efficient, but allows survival in habitats which lack oxygen

Pls, I need help with this! Biology Thank you :)

Answers

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

Explain the mechanism of ventilation in human lungs (you should talk about the diaphragm, abdominal muscles and rib cage and intercostal muscles)

Answers

Answer: When the diaphragm contracts, it moves inferiorly toward the abdominal cavity, creating a larger thoracic cavity and more space for the lungs. Contraction of the external intercostal muscles moves the ribs upward and outward, causing the rib cage to expand, which increases the volume of the thoracic cavity.

The movement of diaphragm and ribs govern the mechanism of ventilation in human lungs.

The ventilation in human lungs or pulmonary ventilation is defined as the process of intake of air during inhalation, and expiration as the release out of air. It is also termed as breathing.

What is the mechanism of pulmonary ventilation?

The lungs are present in the thoracic cavity, with the diaphragm below the lungs separating the thoracic cavity from the abdominal cavity. The rib cage is present outside lungs and prevent them.

Inhalation process in pulmonary ventilation

The inhalation is the process of taking in air. The increase in the volume of lungs results in the increased movement of diaphragm to the abdominal cavity.

The intercostal muscles move upwards and the rib cage move outwards. Thus, the air is inhaled in the system.

Exhalation process in pulmonary ventilation

The exhalation of air is performed antagonist to the inhalation. The relaxation of diaphragm and the movement of rib cage results in the decreased volume of the lungs, and the air is expelled.

Thus, the movement of diaphragm and ribs govern the mechanism of ventilation in human lungs.

Learn more about pulmonary ventilation, here:

https://brainly.com/question/1933493

Which option identifies the most likely contributor to a microclimate that forms in a northern-facing valley?


exposure

shelter

precipitation

topography

Answers

Answer:

Topography

Explanation:

I just took the quiz.

Answer: pretty sure it’s topography

Explanation: edge 2021

What does an ecopsychologist study? a. the mental health of environmental scientists b. the relationship between animals' interactions and their mental health c. the relationship between animals' behavior and the environment d. the relationship between a person's mental health and the environment

Answers

Answer:

The correct answer is d. the relationship between a person's mental health and the environment.

Explanation:

Ecopsychology is aimed at identifying the way in which the emotional aspects of human beings are influenced by the environment, that is, ecopsychology collects multiple experiences that connect human development with environmental awareness. Ecopsychologists are oriented to the search for the well-being of the human being through its connection with natural processes through the understanding of the complex interrelationships between people and the environment.

Answer:

The correct answer is d. the relationship between a person's mental health and the environment.

Explanation:

Ecopsychology is aimed at identifying the way in which the emotional aspects of human beings are influenced by the environment, that is, ecopsychology collects multiple experiences that connect human development with environmental awareness. Ecopsychologists are oriented to the search for the well-being of the human being through its connection with natural processes through the understanding of the complex interrelationships between people and the environment.

Biology Grade 8
Match correct terms/meaning given in column 'B' with their correct levels
given in column 'A' with Column 'B'

Column A
a.Cell
b.Plant
c.Tissue
d.nose
e.organelle

column B
a.Group of similar cells
b.Heart
c.Ova
d.Organ
e.Group of different cells
f.Nucleus
g.organism

Answers

Answer:

cell=ova

plant=organism

tissue=group of similar cells

nose=organ

organelle=nucleus

Astrology, look at the screenshot

Answers

Answer:

the day would get shorter.

hope it helps.

Answer:

year would get longer

Explanation:

Three things can happen at the boundaries between earths plates. If one plate moves underneath another it’s called a

Answers

Answer:

I believe it is called SUBDUCTION.

Earth's plates are called TECTONIC PLATES BTW

seasons work help needed please

Answers

Answer:

July

Explanation:

it is typically the warmest month of the year globally because the Northern hemisphere has more land masses than the southern hemisphere

The roots allow for plants to bring in carbon dioxide and release oxygen.
True
False

Answers

Answer:

true 100 percent

Explanation:

Why would the atomic number be better to identify an element than the atomic mass?

Answers

Answer:

because the atomic number tells you how many protons and neutrons there are

Explanation:

please asap help i am not even sure if my ans is correct but help me out

Answers

Step 2 should be sensory neurons send electrical signals to the brain

Step 3 brain learns information about the environment

Step 4 brain sends electrical signals to the muscles

Answer and Explanation:

Step 1:

Sound waves reach the bat's ears.

Step 2:

Sensory neurons send electrical signals to the brain.

Step 3:

Brain learns information about the environment.

Step 4:

Brain sends electrical signals to the muscles.

Step 5:

Bat flies away from the owl.

This is the correct way^

#teamtrees WAP (Water And Plant)

Please help me out!

Diploid is to Body Cell as Haploid is to?
-Sex Cells
-Zygote
-Chromosome
-Sex Chromosome

Answers

i believe it’s sex cells

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

Other Questions
A small company is deciding which service to use for an enrollment system for their online training website. Choices are MySQL on Amazon Elastic Compute Cloud (Amazon EC2), MySQL in Amazon Relational Database Service (Amazon RDS), and Amazon DynamoDB. Which combination of use cases suggests using Amazon RDS? (Select THREE. ) Data and transactions must be encrypted to protect personal information. The data is highly structured Student, course, and registration data are stored in many different tables. The enrollment system must be highly available. The company doesn't want to manage database patches. which of the actions would cause the molecules of a gas to get closer together? Bill is playing a game of chance of the school fair He must spin each of these 2 spinnersIf the sum of these numbers is an even number, he wins a prize.What is the probability of Bill winning?What is the probability of Bill spinning a sum greater than 15? When given a set of cards laying face down that spell M, A, T, H, I, S, F, U, N, determine the probability of randomly drawing a vowel. three tenths three sixths one ninth one third how are superman and lois genetically compatible B. Answer the question.How is living in space different from living on Earth? Draw structures for the alkene (or alkenes) that gives the following reaction product. Br Br2 2123 Br You do not have to consider stereochemistry . Submit more than one structure only if the structures are constitutional isomers. a report which focuses on individual customers and shows total profit margin generated by specific customers is known as a profitability report. This is called___ implement a move constructor and a move assignment operator in this class, which will require modifications to two files:Add the declaration of a move constructor and a move assignment operator into the class declaration in /ArrayList.hpp.Create a new C++ source file /problem1.cpp, in which you'll write the definition of the move constructor and move assignment operator in the ArrayList class. (Notably, this means you will not write it in /ArrayList.cpp. This also means that /problem1.cpp will need to say #include "ArrayList.hpp" fairly early on. Ordinarily, there's value in implementing all of a class' member functions in one source file, but we'd only like you to submit these two functions in /problem1.cpp, so we'll need them in a separate file.)Additionally, add comments above each of these functions in your /problem1.cpp file that specify the asymptotic notation that best indicates how long they would take to run on an ArrayList whose size is n and whose capacity is c, along with a brief description a sentence or two is fine of why.// ArrayList.hpp#ifndef ARRAYLIST_HPP#define ARRAYLIST_HPP#includeclass ArrayList{public:ArrayList();ArrayList(const ArrayList& a);~ArrayList();ArrayList& operator=(const ArrayList& a);std::string& at(unsigned int index);const std::string& at(unsigned int index) const;void add(const std::string& s);unsigned int size() const;unsigned int capacity() const;private:std::string* items;unsigned int sz;unsigned int cap;};#endif // ARRAYLIST_HPP********************************************************************************************************************************// ArrayList.cpp#include "ArrayList.hpp"namespace{const unsigned int initialCapacity = 10;void arrayCopy(std::string* target, std::string* source, unsigned int size){for (unsigned int i = 0; i < size; i++){target[i] = source[i];}}}ArrayList::ArrayList(): items{new std::string[initialCapacity]}, sz{0}, cap{initialCapacity}{// std::cout Consider the following system at equilibrium where Kc = 9.5210-2 and H = 18.8 kJ/mol at 350 K. CH4 (g) + CCl4 (g) goes to 2 CH2Cl2 (g) The production of CH2Cl2 (g) is favored by: Indicate True (T) or False (F) for each of the following: 1. decreasing the temperature. 2. decreasing the pressure (by changing the volume). 3. increasing the volume. 4. removing CH2Cl2 . 5. removing CCl4 . Teachers are paid a ths of the year. The pre Salary data ditional information.) earest dollar $432 per month $654 per month $872 per month $1,045 per month $1,550 per month Teachers of two-day program Teachers of three-day program: Teachers of four-day program: Teachers of five-day program Preschool director's sala e statement for the enti projected income for th ounts to the nearest doll Greatland Preschool has 9 two-day program teachers, 2 three-day program teachers, 3 four-day program teachers, and 4 five-day program teachers. The preschool also has a director More Info In addition to the salary expense, the preschool must pay federal payroll taxes (FICA taxes) in the amount of 765% of salary expense. The preschool leases its facilities from a local church, paying $4,020 every month it operates. Fixed operating expenses (telephone, internet access, bookkeeping services, and so forth) amount to $900 per month over the eight-month school year. Variable monthly expenses (over the eight-month school year) for art supplies and other miscellaneous supplies are $6 per child. Revenue for the entire eight-month school year from tuition, registration fees, and the lunch program is projected to be $241,200 Print Done Requirement 1. Prepare Greatland Preschool's monthly operating budget. Round all amounts to the nearest dollar. (Round amounts to the nearest dollar.) Greatland Preschool Budgeted Monthly Operating Expenses Teachers' salary: 432 2-day program 654 3-day program 872 4-day program 1045 5-day program 1,550 Director salary 4553 Total salary expense 348 Payroll tax expense 4,020 Lease expense 900 Fixed operating expenses 1,080 Variable oneratina exnenses Enter any number in the edit fields and then click Check Answer. Which of these is the main idea of the Social Gospel Movement? Do people behave well and refrain from hurting others or committing crimes only becausethey are afraid of getting caught? Use the following table to determine whether or not there is a significant difference between the average hourly wages at two manufacturing companies.Manufacture 1 Manufacturer 2n1 = 81 n2 = 64x1=$15.80 x2=$15.001 = $3.00 2 = $2.25What is the test statistic for the difference between the means? An experiment was conducted to determine the effectiveness of a method designed to remove oil wastes found in soil. Three contaminated soil samples were treated. After 95 days, the percentage of contamination removed from each soil sample was measured, with a mean of 49. 3 percent and a standard deviation of 1. 5 percent. If we wished to narrow the boundary around for a 98 percent confidence interval to within. 5 percent, how many soil samples should be in our experiment? Suppose a random variable X has density functionf(x) = {cx^-4, if x1{0, else.where c is a constant.a) What must be the value of c?b) Find P(.5 Compare how the narrator explicitly reveals his attitude about his culture identity versus his parents attitudes that are revealed impalicity. Todd Mountain Development Corporation is expected to pay a dividend of $3 in the upcoming year. Dividends are expected to grow at the rate of 10% per year. The risk-free rate of return is 4%, and the expected return on the market portfolio is 19%. The stock of Todd Mountain Development Corporation has a beta of 0.65. Using the constant-growth DDM, the intrinsic value of the stock is _________. prove that f 2 1 f 2 2 f 2 n = fnfn 1 when n is a positive integer. and fn is the nth Fibonacci number.strong inductive charlies utility function is u(xa, xb) = xaxb. his income is $80. if the price of xa is $4 and the price of xb is $5, how many units of good xa will charlie demand?