If f(1) = 0, what are all the roots of the function f (x) = x cubed + 3 x squared minus x minus 3? Use the Remainder Theorem.

Answers

Answer 1

The roots of the cubic function:

f(x)=  x³ + 3x² - x - 3

are x = 1, x= -1, x = -3

How to find the roots of the function?

We want to find the roots of the function:

f(x)=  x³ + 3x² - x - 3

We know that x = 1 is a root, because f(1) = 0.

Then we can write that function as:

(x - 1)*(x - a)*(x - b)

Where a and b are the other two roots, then we need to solve:

x³ + 3x² - x - 3 = (x - 1)*(x - a)*(x - b)

Expanding the right side, we will get:

x³ + 3x² - x - 3 = x³ + (-a - b - 1)x² + (a + b + ab)x + (-ab)

Comparing like terms, we can see that:

(-a - b - 1) = 3

(a + b + ab) = -1

(-ab) = -3

The third equation gives:

ab = 3

Replacing that in the second one we get:

a + b + 3 = -1

a + b = - 1 - 3 = -4

a + b = -4

a = -4 - b

Replacing that in the relation above:

ab = 3

(-4 - b)*b = 3

-4b - b² = 3

b² + 4b + 3  = 0

The zeros of that function are:

[tex]b = \frac{-4 \pm \sqrt{4^2 -4*3*1} }{2*1} \\\\b = \frac{-4 \pm 2}{2}[/tex]

Then if b is the value when we take the positive sign:

b = (-4 + 2)/2 = -1

the value of a is:

a = -4 - b = -4 + 1 = -3

These are the other two roots.

Learn more about roots at:

https://brainly.com/question/20896994

#SPJ1


Related Questions

SOMEBODY PLEASE PLEASE HELP ME
ILL GIVE YOU 5 STARS, BRAINLIEST AND GIVE A HEART PLEASE HELP
(Please answer the questions and )

Answers

Part A ;

For Bus:

mean = 17.5

median = 15

mode= 15 and 16

Range= 17

For walking:

mean = 20.5

median = 20.5

mode= 20 and 21

Range= 3

How to calculate the various variables given above?

For Bus

To calculate the mean:

= 16+14+15+14+31+15/6

= 105/6

= 17.5

To calculate the median;

= 14,14,15,15,16,31

= 15+15/2 = 15

To calculate the range:

= 31-14 = 17

For walking;

To calculate the mean:

= 19+20+20+21+21+22/6

= 123/6

= 20.5 mins

To calculate the median

= 20+21/2

= 20.5

To calculate the mode:

=20 and 21

To calculate the range:

= 22-19

= 3

Learn more about range here:

https://brainly.com/question/26098895

#SPJ1

Sneha went to a shopkeeper to purchase sugar.The dishonest shopkeeper uses a weight of 990 g for measuring 1 kg . If Sneha bought 5/2 kg of sugar, find the amount of sugar she actually got.​

Answers

Sneha actually got 2475 g of sugar instead of 2500 g.

We have,

If the shopkeeper uses a weight of 990 g for measuring 1 kg, it means that he is using a weight that is 10 g less than the actual weight of 1 kg.

So, the actual weight of 1 kg is 1000 g.

Now,
If Sneha bought 5/2 kg of sugar, she should have received:

= (5/2) x 1000 g

= 2500 g

But since the shopkeeper uses a weight of 990 g for measuring 1 kg, the weight of 5/2 kg would be:

= (5/2) x 990 g

= 2475 g

Thus,

Sneha actually got 2475 g of sugar instead of 2500 g.

Learn more about unit conversion here:

https://brainly.com/question/13899873

#SPJ1

The figure below is a net for a cube. 3.9 ft What is the surface area of the cube, in square feet?

Answers

Answer:91.26ft squared

Compare:

58,565 ____ 58,566

Answers

Answer:

58,565 < 58,566

Step-by-step explanation:

You have to determine which number is greater. I usually start comparing from the farthest left digit (In this case, the ten thousands place.) and work my way up


hope this helped :)

in a bag if marbles 1/2 are blue 1/6 are green 1/12 are yellow you pick a marble with out looking what color marble are you most likely going to choose

Answers

Answer: Blue

Step-by-step explanation:

Half of the entire freaking bag is blue,it states it in the question.If there is so many,unless by pure blind luck you will get that.

I hope it helps!

What the meaning of statement this?

Answers

The statement Y = {u: (z X)uez) = U{z: zEX}=UX, means that the set Y is the union of all the sets z that are elements of X. In other words, Y is the set of all elements that are in at least one of the sets in X.

How to explain the statement

The statement can be broken down into two parts:

The first part, Y = {u: (z X)uez), says that Y is the set of all elements u such that u is an element of at least one set z that is an element of X.

The second part, U{z: zEX}=UX, says that the union of all the sets z that are elements of X is equal to the set UX.

The two parts of the statement can be combined to say that Y is the union of all the sets z that are elements of X.

Learn more about set on

https://brainly.com/question/2166579

#SPJ1

Which statement about the location of √7 on the number line is true?
A= It is located at the number 7 on the number line.
B= It is located at the number 3.5 on the number line.
C= It is located between the numbers 2 and 3 on the number line.
D=It is located between the numbers 4 and 9 on the number line

Answers

Answer is C) it is located between the numbers 2 and 3 on the number line

Explanation

The square root of a number is “what number times itself”

2 x 2 = 4

3 x 3 = 9

7 is between 4 and 9 so C is the correct answer

here is my algebra 13 homework screenshot. can somebody please help me! QUICK

Answers

The function which has a range of real numbers is f(x) = -x + 2

Range is the set of the values that the function obtains this set is the values that the function obtains when we put an x value in the function.

In f(x) = -x + 2 when we put any value of x we get real number so the function range is ( -∞ , ∞ )

In g(x) = -x² when we put any value of x we get all negative number function range is (-∞ , 0]

In h(x) = [tex]2^{x}[/tex] + 1 when we put any value of x we get all positive number so the function range is (1 , ∞)

To know more about range click here :

https://brainly.com/question/28135761

#SPJ1

Given that A={1,2,3,4,5} list the elements of the following sets. i.{x2:x€A} ii.{ :x€A} iii.{2x :x€A} iv.{4x+1:x€A}

Answers

I honestly have no idea what it is but a:3452+6x+5

Answer:no idea

Step-by-step explanation:

Emilia loves to play the piano but doesn't like practicing the exercises her piano teacher assigns. Emilia knows the exercises will help her play better though, so she tries to motivate herself using her favorite treat — chocolate chip cookies. There is a proportional relationship between the amount of time (in hours) that Emilia practices the piano, x, and how many cookies she gives herself, y.
When Emilia practices for 1 hour, she gives herself 4 cookies. Write the equation for the relationship between x and y.

Answers

Answer: Is it x=y(4)? Can someone tell me if that's right?

Step-by-step explanation:

Given f(x)=4x^2 - 1 and g (x) = 2x- 1 , find each function
1. ( f+g )( x )
2. ( fg ) ( x )
3. ( f^n ) ( x )

Answers

The values of the composite functions are

(1) (f + g)(x) = 4x² + 2x - 2

(2) (fg)(x) = 8x³ - 4x² - 2x + 1

(3) (fⁿ)(x) = (4x² - 1)ⁿ

How to evaluate the composite functions

From the question, we have the following functions that can be used in our computation:

f(x) = 4x² - 1

g(x) = 2x - 1

Using the above as a guide, we have the following:

(f + g)(x) = f(x) + g(x)

(f + g)(x) = 4x² - 1 + 2x - 1

Evaluate the like terms

(f + g)(x) = 4x² + 2x - 2

(fg)(x) = f(x) * g(x)

(fg)(x) = (4x² - 1) * (2x - 1)

Evaluate the products

(fg)(x) = 8x³ - 4x² - 2x + 1

(fⁿ)(x) = (f(x))ⁿ

So, we have

(fⁿ)(x) = (4x² - 1)ⁿ

Read more about composite functions at

https://brainly.com/question/10687170

#SPJ1

FInd the measure of the arc using the picture provided , please and thanks

Answers

The measure of arc angle QTP is 204 degrees.

How to find arc angle?

When a tangent and a secant intersect outside a circle then the measure of the angle formed is one-half the positive difference of the measures of the intercepted arcs.

Therefore, let's find the measure of arc angle QTP as follows:

90 = 0.5(x - 68)

90 = 0.5x - 34

0.5x = 124

x = 124 / 0.5

x = 248 degrees

Where

x = arc angle TSQ

Therefore,

arc QP = 44 degrees

Therefore,

arc QTP = 248 - 44

arc QTP = 204 degrees

learn more on arc angle here: https://brainly.com/question/22826189

#SPJ1

Question 5
TABLE 4 below shows the distribution of revenue among the different spheres of
government in South Africa from the 2017/2018 to 2021/2022 financial year. Some values
have been omitted.
TABLE 4: Distribution of Revenue among the different government spheres for
the financial years 2017/2018 to 2021/2022.
R(billion)
2019/20
546.1
471,4
Government
BHOJDIN
National
Provincial
Local
TOTAL
2017/18
453.4
410.6
**
2018/19
490,00
439,5
87.6
1 017,1
98.3
1:15.8
2020/21
557,5
500,4
103.3
1 161.2
2021/22
1 240.5
(adapted from DBE 2014 MLQP)
Use the table above to answer questions that follows
When the revenue of the local government sector was compared to the provincial sec
2017/18, it was found to be 20, 12% of the provincial sector.
Calculate
the missing value E, the total revenue for the period 2017/18.
ont sector always receives a larger share than t

Answers

The missing value E, the total revenue for the period 2017/18, is approximately 82.61 billion.

How to calculate the value

Local government sector's revenue in 2017/18 (L): Missing value (to be calculated)

Provincial sector's revenue in 2017/18 (P): 410.6 (billion)

According to the information provided, L is 20.12% of P. Mathematically, we can write this as:

L = 20.12/100 * P

Substituting the known value of P, we get:

L = 20.12/100 * 410.6

L ≈ 82.61 (rounded to two decimal places)

Therefore, the missing value E, the total revenue for the period 2017/18, is approximately 82.61 billion.

Learn more about revenue on

https://brainly.com/question/29786149

#SPJ1

how many triangles?(urgent)

Answers

There are 75 triangles that can be formed using these 9 vertices.

Here we have,

We have 9 vertices arranged in a pattern where 5 vertices are above and 4 vertices are below in a parallel direction.

And we want to know how many triangles can be formed using these vertices.

In order to this,

Count the number of ways to choose 3 vertices from the 9 vertices.

This can be done using the combination formula, which is:

[tex]^{9}C_{3}[/tex] = 9! / (3! * (9-3)!)

      = 84.

Since,

A degenerate triangle is one where all three vertices lie on the same line. To count the number of degenerate triangles,

We need to count how many ways we can choose 3 vertices that lie on the same line.

There are 5 lines with 3 points each (the 5 lines with the upper vertices). So the number of degenerate triangles is:

5 [tex]^{3}C_{3}[/tex] + 4  [tex]^{3}C_{3}[/tex] = 9.

Subtract the number of degenerate triangles from the total number of triangles to get the number of non-degenerate triangles.

Therefore, the number of non-degenerate triangles is:

84 - 9 = 75.

To learn more about combinations visit:

https://brainly.com/question/28720645

#SPJ1

A random number from 1 to 5 is selected 50 times. The number 1 is selected 13 times, 2 is s elected 8 times, 3 is selected 14 times, 4 is selected 6 times, and 5 is selected 9 times. What (äbä 2) *?is the relative frequency of selecting a 2

Answers

The relative frequency of selecting the number 2 is 0.16 or 16%.

Relative Frequency is a proportion or percentage which is calculated with the help of given frequency.

To calculate the relative frequency of selecting the number 2, you need to divide the number of times 2 was selected by the total number of selections. In this case, 2 was selected 8 times out of a total of 50 selections.

Relative frequency of selecting 2 = (Number of times 2 was selected) / (Total number of selections)

= 8 / 50

= 0.16

Therefore, the relative frequency of selecting the number 2 is 0.16 or 16%.

For such more questions on relative frequency

https://brainly.com/question/26177128

#SPJ11

Find the average rate of change of f(x)=x²+2x+1 from x=4 to x=6.

Answers

The average rate of change of the function over the interval is 12

Finding the average rate of change

From the question, we have the following parameters that can be used in our computation:

f(x) = x² + 2x + 1

The interval is given as

From x = 4 to x = 6

The function is a quadratic function

This means that it does not have a constant average rate of change

So, we have

f(4) = 4² + 2(4) + 1 = 25

f(6) = 6² + 2(6) + 1 = 49

Next, we have

Rate = (49 - 25)/(6 - 4)

Evaluate

Rate = 12

Hence, the rate is 12

Read more about average rate of change at

brainly.com/question/17131025

#SPJ1

Given f(x) = x^2 what is the range of g(x) = f(x+2)-5

Answers

The range of the function g(x) = f(x+2)-5 is:

R = [0, ∞)

What is the range of g(x) = f(x+2)-5?

For a function y = f(x), we define the range as the set of possible outputs of the function.

Here we want to find the range of:

g(x) = f(x+2)-5

Where f(x) = x²

Replacing f(x) in the rule for g, we will get the composition:

g(x) = (x + 2)² - 5

The first part can only be a positive number or 0, then the minimum of the range is -5

And then the function only grows, then the range of g(x) is:

R = [0, ∞)

Learn more about ranges at:

https://brainly.com/question/10197594

#SPJ1

What is one-way ANOVA?
Discuss and explain how the five steps of hypothesis testing are used in one-way ANOVA.

Answers

One-way ANOVA utilizes the five steps of hypothesis testing to determine if there are significant differences among the means of three or more groups.

One-way ANOVA, or analysis of variance, is a statistical test used to compare the means of three or more groups to determine if there are significant differences among them. It helps in determining whether the variations between the group means are due to random chance or if they are statistically significant.

The five steps of hypothesis testing are commonly used in one-way ANOVA to analyze and draw conclusions from the data. These steps are as follows:

1. Formulating the null and alternative hypotheses: In one-way ANOVA, the null hypothesis (H0) states that there are no significant differences between the group means, while the alternative hypothesis (Ha) states that at least one group mean differs significantly from the others.

2. Choosing a significance level: The significance level, denoted as α, represents the threshold below which the null hypothesis is rejected. Commonly used values for α are 0.05 or 0.01, indicating a 5% or 1% chance, respectively, of rejecting the null hypothesis incorrectly.

3. Computing the test statistic: In one-way ANOVA, the test statistic is the F-statistic, which compares the between-group variation to the within-group variation. It measures the ratio of the mean square between (MSB) to the mean square within (MSW).

4. Determining the critical value: The critical value is derived from the F-distribution table and depends on the significance level and the degrees of freedom associated with the numerator and denominator of the F-statistic.

5. Making a decision: If the calculated F-value is greater than the critical value, the null hypothesis is rejected, and it can be concluded that there are significant differences between at least two group means. Conversely, if the calculated F-value is smaller than the critical value, the null hypothesis is not rejected, indicating that there is no significant difference between the group means.

If the null hypothesis is rejected, post-hoc tests can be conducted to determine which specific group means differ significantly from each other.

one-way ANOVA utilizes the five steps of hypothesis testing to determine if there are significant differences among the means of three or more groups.

To know more about ANOVA .

https://brainly.com/question/30459773

#SPJ11

Please help I need this for my final to pass and graduate ☹️

Answers

Another representation of (1, 1/4 π)  in which r> 0, 2π < θ < 4π is (1, 3/4 π)

Understanding Bi-polar Coordinate

In Bi-polar Coordinates, the point (1, 1/4 π) can be represented in polar coordinates as (r, θ).

Where r is the distance from the origin to the point and θ is the angle between the positive x-axis and the line segment connecting the origin to the point.

a. For r> 0, 2π < θ < 4π

Add 2π to the original angle of 1/4 π:

(r, θ+2π) = (1, 1/4 π + 2π)

              = (1, 9/4 π)

b. For r < 0, 0 < θ < 2π,

Add  π and reflect the original point across the origin:

(r, θ+π) = (-1, 1/4 π + π)

           = (-1, 5/4 π)

c. For r> 0, -2π < θ < 0,

Subtract 2π from the original angle of 1/4 π:

(r, θ-2π) = (1, 1/4 π - 2π)

             = (1, -7/4 π)

Learn more about bipolar coordinate here:

https://brainly.com/question/27917217

#SPJ1

Teena uses 1/4 cup of oil for a cake. How many cakes can she make if she has 6 cups of oil?

Answers

Answer:

24 cakes.

Step-by-step explanation:

6 cups of oil divided by 1/4 cup oil per cake = 24 cakes

6/(1/4) = 24

or 6/(0.25) = 24

She can make 24 cakes with 6 cups of oil.

Can someone please help me find the domain and range thank you all so much for the help

Answers

The domain and the range of the graph are Domain = [-10, -8] and Range = [-10, -1]

Calculating the domain and range of the graph

From the question, we have the following parameters that can be used in our computation:

The graph

The above graph can be represented as a list of ordered pairs

The rule of a graph is that

The domain is the x valuesThe range is the f(x) values

Using the above as a guide, we have the following:

Domain = [-10, -8]

Range = [-10, -1]

Read more about domain and range at

brainly.com/question/27910766

#SPJ1

find the area of a triangle whose base is 8 inches and whose height is 12 in.
(a) 96in.²
(b) 10in ²
(c) 20in.²
(d) 48in.²​

Answers

Answer:

48in.²

Step-by-step explanation:

The formula for the area of a triangle is 1/2 x b x h

Since the b = 8 and the h = 12, substitute 8 and 12 for b and h.

1/2 x 8 x 12

4 x 12

48in.²

Answer:

d

Step-by-step explanation:

area= ½ × b × h

= ½ × 8 × 12

= ½ × 96

= ⁹⁶/²

= 48in²

A spinner has three sections. The table shows the results of spinning the arrow on the spinner 80 times.

What is the experimental probability of the arrow stopping over Section 1?
A} 1/28
B} 7/20
C} 7/13
D} 4/5

Answers

Answer:

B} 7/20

Step-by-step explanation:

total: 80

section 1: 28

p(section 1) = 28/80 = 7/20

Can someone please answer and provide an explanation for these problems?

Answers

The slope of each line is given as follows:

58) -2.

59) 1.

60) -2/3.

61) 2.

How to define a linear function?

The slope-intercept equation for a linear function is presented as follows:

y = mx + b

The parameters of the definition of the linear function are given as follows:

m is the slope.b is the intercept.

When two lines are parallel, they have the same slope, which are the cases for itens 58 and 59, as the slope is given by the multiplier of x.

When two lines are perpendicular, we have that the multiplication of the slopes of the line is of -1, hence the slope for item 60 is given as follows:

3m/2 = -1

3m = -2

m = -2/3.

For item 61, the slope is given as follows:

-m/2 = -1

m = 2.

More can be learned about linear functions at https://brainly.com/question/15602982

#SPJ1

50 Points! Multiple choice geometry question. Photo attached. Thank you!

Answers

Answer:

The correct answer:

(B) reduction

What is the median of the following set of numbers? 35, 33, 36, 34, 33, 33, 32, 38, 35
A.35
B. 34
C.33
D.36

Answers

Median of the set is 34, as it is the middle value of the ordered set (32, 33, 33, 33, 34, 35, 35, 36, 38).

To find the middle of a bunch of numbers, the initial step is to organize the numbers all together from least to most prominent. For this situation, the arranged set is: 32, 33, 33, 33, 34, 35, 35, 36, 38.

The middle is the center number in the arranged set. On the off chance that there is an odd number of values, the middle is the center worth. On the off chance that there is a considerably number of values, the middle is the normal of the two center qualities.

For this situation, there are nine qualities in the set, which is an odd number. The center worth is the fifth worth, which is 34. Thusly, the middle of the set is B. 34.

To confirm, we can count four qualities before 34 and four qualities after 34 in the arranged set. Since there are an equivalent number of values when the middle, we can infer that 34 is for sure the middle.

To learn more about median, refer:

https://brainly.com/question/12730221

#SPJ1

Please help with pictures below.

Answers

The proportion is solved and the variables are a/b = c/d

Given data ,

Let the proportion be represented as A

Now , the value of A is

a / b = c / d

On simplifying the equation , we get

( a + b ) / b = ( c + d ) / d

On dividing the numerator of the fraction by the denominator , we get

( a / b ) + ( b / b ) = ( c / d ) + ( d / d )

On further simplification , we get

( a / b ) + 1 = ( c / d ) + 1

Subtracting 1 on both sides , we get

( a / b ) = ( c / d )

Hence , the proportion is ( a / b ) = ( c / d )

To learn more about proportion click :

https://brainly.com/question/7096655

#SPJ1

MA.7.DP.1.4
A group of friends has been given $800 to host a party. They must decide how much money
will be spent on food, drinks, paper products, music and decorations.
Part A. As a group, develop two options for the friends to choose from regarding how to
spend their money. Decide how much to spend in each area and create a circle
graph for each option to represent your choices.
Part B. Mikel presented the circle graph below with his recommendations on how to
spend the money. How much did he choose to spend on food and drinks? How
much did he choose to spend on music?
Party Spending Proposal
Mail
17%
Paper Products

Answers

Answer:  $130 money did Brenda and Hazel have all together before buying decorations and snacks.

Here, we have,

You want to know Brenda and Hazel's combined money when the ratio of their remaining balances is 1 : 4 after Brenda spent $58 and Hazel spent $37. They had the same amount to start with.

Setup

Let x represent the total amount the two women started with. Then x/2 is the amount each began with, and their fnal balance ratio is ...

 (x/2 -58) : (x/2 -37) = 1 : 4

Solution

Cross-multiplying gives ...

 4(x/2 -58) = (x/2 -37)

 2x -232 = x/2 -37 . . . . . . eliminate parentheses

 3/2x = 195 . . . . . . . . . . . . add 232-x/2

 x = (2/3)(195) = 130 . . . . . multiply by 2/3

Brenda and Hazel had $130 altogether before their purchases.

Alternate solution

The difference in their spending is $58 -37 = $21.

This is the same as the difference in their final balances.

That difference is 4-1 = 3 "ratio units", so each of those ratio units is $21/3 = $7.

Their ending total is 1+4 = 5 ratio units, or $35.

The total they started with is $58 +37 +35 = $130.

To earn more on addition click:

brainly.com/question/29560851

#SPJ1

complete question:

Brenda and Hazel decide to throw a surprise party for their friend, Aerica. Brenda and Hazel each go to the store with the same amount of money. Brenda spends $58 on decorations, and Hazel spends $37 on snacks. When they leave the store, the ratio of Brenda’s money to Hazel’s money is 1 : 4. How much money did Brenda and Hazel have all together before buying decorations and snacks?

What are the zeros of the function

Answers

Answer: i think c

Step-by-step explanation:

100 Points! Algebra question. Photo attached. Please show as much work as possible. Thank you!

Answers

The probability of the digestive tract disease, given a positive test result, is 45%.

A. Two-Way Frequency Table:

Let's create a two-way frequency table to represent the situation:

                                      Test Positive             Test Negative           Total

Disease Present                   A                                 B              5,000

Disease Not Present           C                                 D              95,000

Total                                   5,000                     95,000     100,000

In this table:

A represents the number of sheep that have the disease and test positive.B represents the number of sheep that have the disease but test negative.C represents the number of sheep that do not have the disease but test positive.D represents the number of sheep that do not have the disease and test negative.

B. Probability of Disease Given Positive Test Result:

P(Disease | Positive)

= (P(Positive | Disease) x P(Disease)) / P(Positive)

= 0.94  x 0.05 / P(Positive)

To calculate P(Positive), we can use the law of total probability:

P(Positive) = P(Positive | Disease) x P(Disease) + P(Positive | No Disease) x P(No Disease)

So, P(Positive | No Disease) = 1 - P(Test Negative | No Disease)

= 1 - 0.94 = 0.06

P(No Disease) = 1 - P(Disease) = 1 - 0.05 = 0.95

Now, P(Positive) = (0.94 x 0.05) + (0.06 x 0.95)

= 0.047 + 0.057

= 0.104

Finally, we can calculate P(Disease | Positive):

P(Disease | Positive) = (0.94 x 0.05) / 0.104

= 0.047 / 0.104

≈ 0.452

Therefore, the probability of the digestive tract disease, given a positive test result, is 45%.

Learn more about Probability here:

https://brainly.com/question/31828911

#SPJ1

Other Questions
suppose the population of bears in a national park grows according to the logistic differentialdp/dt = 5P - 0.002P^2where P is the number of bears at time r in years. If P(O)-100, find lim Po) A study of blood pressure and age compares the blood pressures of men in three age groups: less than 30 years, 30 to 55 years, and over 55 years. Select the best method to analyze the data. a. Wilcoxon rank sum test b. Mann-Whitney test c. Kruskal-Wallis test d. Wilcoxon signed rank test Suppose that you borrow $10,000 on a 60-month car loan at 6.25% APR. Compute the monthly payment. a. Set up an equation for the problem using the following variables: n i pv pmt fv; where n=number of periods and i= interest rate per periodWhat is the actual formula?Does this one work? Part of a homeowner's insurance policy covers one miscellaneous loss per year, which is known to have a 10% chance of occurring. If there is a miscellaneous loss, the probability is c/x that the loss amount is $100x, for x = 1, 2, ...,5, where c is a constant. These are the only loss amounts possible. If the deductible for a miscellaneous loss is $200, determine the net premium for this part of the policythat is, the amount that the insurance company must charge to break even. if the enzyme-catalyzed reaction e s es e p is proceeding at or near the vmax of e, what can be deduced about the relative concentrations of s and es What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history? Using the article "You Trouble" discuss whether or not stunt videos cause teens to take risks and increase impulsive behavior consider the given state of stress. take a = 21 mpa and b = 45 mpa. determine the principal planes. the principal planes are at and .Determine the principal planes using Mohr's circle. a) The principal planes are at and .Determine the principal stresses using Mohr's circle. b)The minimum principal stress is MPa, and the maximum principal stress is MPa.Determine the orientation of the planes of maximum in-plane shearing stress using Mohr's circle. c) The orientation of the plane of maximum in-plane shearing stress in the first quadrant is . The orientation of the plane of maximum in-plane shearing stress in the second quadrant is .Determine the maximum in-plane shearing stress using Mohr's circle. d) The maximum in-plane shearing stress is MPa.Determine the normal stress using Mohr's circle. e)The normal stress is MPa. What are the three key components of the production process? machines, equipment, and tools purchasing, sales, and distribution testing, quality assurance, and compliancematerials, machines, and people let a2 = a. prove that either a is singular or det(a) = 1 relative to the current dsm-iv system of classifying mental disorders, the five-factor model suggests question Q#6 If a roan bull is crossed with a white cow, what percent of offspring will have a roan phenotype? 100% 753 25 SON Question 7 Q#7 Both Mrs. Smith and Mrs Jones had baby girls the same day in the same hospital. Mrs. Smith took home a baby girl, who she ca Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect however, that her child and the Smith baby had accidentally switched in the nursery. Blood tests were made. Mr. Smith is Type A Mes Smith is Type B. Mr. Jones is Type A Mestone Type A. Shirley is Type O, and Jane is Type B. Had a mix-up occurred, or is it impossible to tell with the given information it is impossible to tell with the oven Information Alkup occured. The Smiths could not have had a bay with type o blood Amb up occured. The Jones could not have had a baby with Type B blood Amik up occured. Neither parents could have produced a baby with the stated blood type Question 8 Gomovies.com Q8 If a man of genotype i marries a woman of genotype what possible blood types could their children have their children could have A Bor AB blood types their children could have A st As blood types their children could have A B. ABor blood types the children could have A or blood tyres Search O 31 Question 2 of 10Which question would be most appropriate to ask yourself when consideringhow to address your audience for a procedural document?OA. What research do I need to do to understand my topic?B. Will readers respond best to a formal or informal style?OC. Why can't I find a good image to illustrate my points?OD. Where can I go for information about my topic?WSUBMIT if you are asked to speak for 10 minutes at a luncheon meeting, it is appropriate for you to go 5 or 10 minutes beyond this.t/F For each question, you will want to answer the following:What type of analysis should be used to answer this question? Why?You should run the proper analysis and then interpret the answer.********If the restaurant is planning to have a waterfront view, should they plan to build segments around marital status?If the restaurant is planning to target a more affluent audience, what should they consider with elegant vs. simple decor options?Should the restaurant choose a jazz combo or a string quartet?What is the average family size of the population under study?