Identify the Property Below:
ab² • 0 = 0 ______
(7 + 5) + 1 = 7 + (5 + 1) _____
6 = 6 ____
7(x-3) = 7x - 21 ______
x + (-x) = 0 ___
if y = 3, then 3 = y ___
if x = -1, and -1 = z, then x = z ____
4x • 1 = 4x ____
(a+b) + 0 = (a+b) ____
3 • 1/3 = 1 ___

Answers

Answer 1

The properties are listed below.

What is properties of multiplication and addition?

Properties of addition and multiplication are defined for the various conditions and rules of addition and multiplication.  The properties are:

Commutative propertyAssociative Property Distributive Property  Identity Property

ab² • 0 = 0

The product between any number and this one is zero. This comes from the existence of zero, which states that there must exist a value that represents nothingness, the zero.

(7 + 5) + 1 = 7 + (5 + 1)

This is the associative property of addition,

6 = 6

This is the reflexive property of equality, which says that every number is equal to itself.

7(x-3) = 7x - 21

This is the distributive property of addition which says ,

C*(A + B) = C*A + C*B

x + (-x) = 0

This is the inverse property of addition, this property says that for any real number x there exists a real number -x such that x+(-x)=0.

if y = 3, then 3 = y

This is the symmetric property.

if x = -1, and -1 = z, then x = z

This is the transitive property, we can apply it in the next way

then x = z

4x • 1 = 4x

This is the identity property of multiplication.

(a+b) + 0 = (a+b)

This is identity property of addition is that when a number n is added to zero, the result is the number itself i.e. n + 0 = n.

3 • 1/3 = 1

This is inverse property of multiplication. It states that if you multiply a number by its reciprocal, also called the multiplicative inverse, the product will be 1

Hence, the properties are identified.

Learn more about properties of multiplication and addition here:

https://brainly.com/question/29144954

#SPJ1


Related Questions

let t(n) be number of all the positive divisors of n. prove that t(n) is odd only if n is a perfect square

Answers

We must establish both of the following statements in order to demonstrate that t(n) is unusual if and only if n is a perfect square.

First instruction: If t(n) is odd, n is a perfect cube.

Assume that t(n) is strange. All the positive divisors of n should be d 1, d 2, ldots, and d k. So, we understand that k=t(n) is unusual. The divisors can be combined into frack2 pairs, with a sum of n for each pair:

(d 1, d k), (d 2, d k-1)

If k is odd, only one divisor remains, which, if n is a perfect cube, is the square root of n. The conclusion is that n must be a perfect square if t(n) is unusual.

Second instruction: If t(n) is odd, then n is a perfect square and n is.

Let's assume that n is a perfect square, such as n=m2. Then, the positive divisors of n appear in pairs, denoted by (d, fracnd), where d spans all the divisors of m. We only need to tally the divisor d when d=fracnd because the product d cdot fracnd = n is not a perfect square if d is not equal to fracnd. Since m has an odd number of divisors, t(n) is only odd if and only if m.

We can look at m's prime factorization to understand why it has an odd amount of divisors. Write m=p 1,p 2,a 1,a 2,ldots,p k where p 1,p 2,a 1,a 2,ldots,p k are distinct prime numbers and a 1,a 2,ldots,a k are positive integers.

As a result, we have demonstrated that t(n) is odd only when n is a perfect square.

Learn more about square here:

https://brainly.com/question/14198272

#SPJ4

Answer to a question

Answers

The type and degree of association is As the time a basketball player practices increases, the number of points scored in a game increases with a strong nonlinear association, the correct option is B

What does correlation coefficient convey?

The correlation coefficient is the degree of association between two quantities in term of linear relation.

The range of correlation coefficient is -1 to 1

when the correlation is -1, then that means  as the one quantity increases, the other quantity decreases (linearly)

when the correlation is 0, then there is no linear relationship between two variables.

when the correlation is 1, then that means  as the one quantity increases, the other quantity increases(linearly) and vice versa for decrement.

Given the graph

Now, a function is an expression, that describes the relationship between one variable (the independent variable) and another variable (the dependent variable) .

Linear function, the graph is a straight line

Therefore, by correlation coefficient answer will be B

Learn more about correlation coefficient here:

https://brainly.com/question/10725272

#SPJ9

The graph of g(x), shown below in pink, has the same shape as the graph of
f(x) = x², shown in gray. Which of the following is the equation for g(x)?
in
OA. g(x) = (x-3)²-1
OB. g(x) = (x + 1)² - 3
OC. g(x)=(x-1)²-3
OD. g(x) = (x+3)2-1
f(x)
(0,0)
g(x)
(3,-1)

Answers

on solving the provided question we can say that the function at  (h, k) = (1, - 3), will be [tex]g(x) = (x - 1)^2 - 3- > B[/tex]

what is function?

Mathematics deals with numbers and their variants, equations and associated structures, forms and their positions, and locations where they might be found. The term "function" describes the connection between a group of inputs, each of which has a corresponding output. A function is an association between inputs and outputs where each input results in a single, unique outcome. A domain and a codomain, or scope, are assigned to each function. Functions are often denoted by the letter f. (x). The input is an x. On functions, one-to-one functions, many-to-one functions, within functions, and on functions are the four primary categories of functions that are available.

The graph of g(x) has its vertex at (1, - 3)

The equation of a parabola in vertex firm is

[tex]y = a(x - h)^2 + k[/tex]

(h, k) =coordinates of the vertex

and

a is a multiplier

(h, k) = (1, - 3),

[tex]g(x) = (x - 1)^2 - 3- > B[/tex]

To know more about function visit:

https://brainly.com/question/28193995

#SPJ1

Find the vertices of the ellipse defined by the equation shown below. If necessary, round to the nearest tenth.
16x² +9y² - 128x − 36y + 148 = 0

Answers

The vertices of the ellipse are:-

x = 3.625; x = 4.375

y = 0; y = -3

What is an ellipse?

An ellipse is a plane curve surrounded by two focal points, such that the sum of the two distances to the focal points is a constant for all points on the curve. It generalises a circle, which is a special type of ellipse with the same two focal points.

We can rewrite the equation to standard form to see the centre and semi-axis lengths.

16x² -128x +y² +3y = -256

16(x² -8x +16) +(y² +3y +2.25) = -256 +256 +2.25

16(x -4)² +(y +1.5)² = 9/4 . . . . . write as squares

(x -4)²/(9/64) +(y +1.5)²/(9/4) = 1 . . . . divide by 9/4

((x -4)/0.375)² +((y +1.5)/1.5)² = 1 . . . . put in useful form

In this form, we have

((x -h)/a)² +((y -k)/b)² = 1

where (h, k) is the centre, 2a is the length of the axis in the x-direction, and 2b is the length of the axis in the y-direction. The required tangents are,

x = h±a

y = k±b

For the given ellipse, the tangent lines are,

x = 4 -0.375 = 3.625, x = 4.375

y = -1.5 -1.5 = -3, y = -1.5 +1.5 = 0

To know more about an ellipse follow

https://brainly.com/question/28701170

#SPJ1

Jeremiah wanted to create step-function that increases more gradually than the greatest integer function, f (r) IlrIl: He decided that the function g(=) [Iellwould work Help Jeremiah by filling in the missing data below; then determine if he was right or wrong that glx) increases more gradually than flx): flx) g(x) 0.51 1.5/1 2.5 3.513 Jeremiah was right to say that g(r) increases more gradually than f()

Answers

Since g(x) increases less frequently than f(x), Jeremiah is correct in saying that g(x) increases more gradually than f(x).

It seems like some of the numbers in the table are cut off. Nevertheless, we can determine if Jeremiah was correct in saying that g(x) increases more gradually than f(x).

From the given information, we know that f(x) = IlxIl (the greatest integer function). This function increases by 1 whenever x crosses an integer value.

Jeremiah's function is g(x) = [x] (the floor function), which is the greatest integer less than or equal to x. This function increases by 1 only when x is an integer.

Since g(x) increases less frequently than f(x), Jeremiah is correct in saying that g(x) increases more gradually than f(x).

To know more about integer function:

https://brainly.com/question/27250114

#SPJ4

A baby is 70 days old. How many hours old is the baby?

Answers

Answer:

The answer to your question is 1680

Step-by-step explanation:

1 day is 24 hours

So to find the answer we will multiply 70 days by 24 hours which will give us 1680 hours.

I hope this helps and have a wonderful day!

What is 20% of 50 with a model to show

Answers

Answer:

10

Step-by-step explanation:

20% = 0.2

What is 20% of 50?

We take

50 x 0.2 = 10

So, 20% of 50 is 10

20% of 50 is equal to 50% of 20, which is half of 20, which is 10.

With this rule, calculating most percentages becomes a piece of cake. Just remember that

A% of B = B% of A

Shown are graphs of the position functions of two runners, A and B, who run a 100-m race and finish in a tie. (a) Describe and compare how the runners run the race. (b) At what time is the distance between the runners the greatest? (c) At what time do they have the same velocity?

Answers

(a) - A runs the race at a constant speed, never speeding up or slowing down. B accelerates throughout the race, starting out slower than A and, by the end, running faster than A.

(b) - Based on the graph, it appears that they are furthest apart after 8 seconds, when they are approximately 30 meters apart.

(c)- The two graphs appear to have the same slope (i.e., velocity) 9 or 10 seconds into the race.

graph attached below,

constant speed

When an object travels the same distance in the same period of time, it is said to be traveling at a constant speed. At constant speed, an object travels a uniform distance in an equal interval of time. The equation of the speed can be given as: S = d t.

Slope

Slope is a measure of the steepness of a line.

Learn more about Speed and distance here :-

https://brainly.com/question/12759408

#SPJ4

According to a recent study, 21% of peanut M&M's are brown, 13% are yellow, 3% are red, 24% are blue, 16%
are orange, and 24% are green. Assume these proportions are correct and suppose you randomly select four
peanut M&M's from an extra-large bag of the candies. Calculate the following probablities. Also calculate
the mean and standard deviation of the distribution. Round all solutions to four decimal places, if
necessary.

Answers

P (X=4)  = 0.0028

P(X=3) or P(X=4) = 0.0326

P (X<=4) = 0.9999

P(X>=4) 0.0029

The standard deviation is 0.8198

What is Standard Deviation?

Standard deviation is a statistical measure of how to spread out a set of data is from its mean or average value. It measures the degree of variation or dispersion of a dataset, which helps in understanding how much the individual data points deviate from the average.

To solve for:

1. P(X=4) = [tex](\frac{5}{4}) (0.16)^4 (1-0.16)^5^-^4[/tex]

= 0.0028.

2. P(X=3) or P(X=4) = [tex](\frac{5}{3}) (0.16)^3 ((1-0.16)^2\\[/tex]

= 0.0326

3. P(X<=4) = [tex](\frac{5}{x})(0.16)^x(1-0.16)5^-^x[/tex]

= 0.9999

4. P(X>=4) = P(X=4) + P(X=5)

= [tex](\frac{5}{4}) (0.16)^4(0.84)^1 + (\frac{5}{5})(0.16)^5[/tex]

= 0.0029.

5. u = np = 0.8

[tex]\sqrt{np(1-p)}[/tex]

= 0.8198

Read more about probabilities here:

https://brainly.com/question/24756209

#SPJ1

How many solutions does each system of {y+4x=7 −2y−4=8x

Answers

The system of equations y+4x=7 and −2y−4=8x has no solutions.

What is Equation?

Two or more expressions with an Equal sign is called as Equation.

The given system of equations are

y+4x=7 ...(1)

−2y−4=8x...(2)

2y+8x=-4

From equation 1

y=7-4x

Simplifying and solving for x, we get:

-14 + 8x - 4 = 8x

-18 = 0

This is a contradiction, since -18 is not equal to 0. Therefore, there is no solution that satisfies both equations.

Hence, the system of equations has no solutions.

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ9

the standard deivation expressed as a percent of the mean is the group of answer choices mean standard error standard error of the mean z-score coefficient of variation

Answers

The standard deviation expressed as a percent of the mean is the D: coefficient of variation.

The coefficient of variation (CV) is a statistical measure that expresses the standard deviation of a data set as a percentage of the mean. It is particularly useful for comparing the variability of different data sets with different units or scales, and for identifying the degree of variation relative to the mean. The formula for the coefficient of variation is:

CV = (standard deviation / mean) x 100%

So, the coefficient of variation is a dimensionless quantity that measures the relative dispersion of the data.

You can learn more about standard deviation at

https://brainly.com/question/475676

#SPJ4

Any consecutive sides of a parallelogram are parallel
true or false

Answers

It is false, consecutive sides of a parallelogram are not parallel.

What is parallelogram?

A parallelogram is a quadrilateral, which is a four-sided polygon with straight sides. It is defined as a four-sided shape in which opposite sides are parallel and congruent (having the same length), and opposite angles are also congruent (having the same measure).

Here,
A parallelogram is a quadrilateral with two pairs of parallel sides. This means that any two opposite sides of a parallelogram are parallel to each other.

Therefore, it is false that, consecutive sides of a parallelogram are not parallel.

Learn more about parallelogram here: https://brainly.com/question/14984005

#SPJ1

Please help !! I can’t find the answer for this

Answers

Answer:

400.059

How do you write this problem as a decimal?

So the first part of this question is four hundred:

400.

But then.. It says fifty nine hundredths. So lets write it out.

The closer we get to the decimal it gets " smaller " example the hundredths is all the way in back and the tenths is all the way to the front! So with that knowledge lets figure it out:

( to make it nice and simple for you ):

0.059

The " 9 " is in the hundredths zone and the " 5 " is in the tenths zone. So just like on top it looks like that.

0.059+400=

400.059

Thus, your answer is 400.059

let v be the (real) vector space of all functions f from r into r. which of the following sets of functions are subspaces of v?

Answers

The following sets of functions are subspaces of v, if v be the (real) vector space of all functions f from r into r is: all f such that f(x²) = f(x²), all f which are continuous.

V is a Vector- Space of all real- valued functions over field of real numbers R and W consists of all real- valued even functions which are bounded also as a subset of V.

Let f , g belong to W then f , g both are even & bounded. Hence ;

(1) (f + g ) is even & bounded because ,

(f + g )(-x ) = f(- x )+ g(-x) = f( x) + g( x )

=( f+g)( x) and for all x€ R and

= | f (x) + g(x) | </= |f (x) | + | g (x) |

</= (c +d) = C(constant)

and similarly for any scalar k€ R , (kf ) will be an even function and it will be bounded also.

A set whose elements, frequently termed vectors, can be added to and multiplied ("scaled") by figures known as scalars is referred to as a vector space (also known as a linear space). Real numbers make up scalars most of the time, but they can also be complex numbers or, more broadly, components of any field. Certain conditions, referred to as vector axioms, must be met by the operations of vector addition and scalar multiplication.

Learn more about Vector space:

https://brainly.com/question/30436280

#SPJ4

If r(t) is the position vector for a smooth curve C, and Î (t), Ñ(t), and B(t) are unit tangent vector, principal unit normal vector, and binormal unit vector, respectively, then 1. B(t) · Î (t) = 2. Þ(t) · B(t) = 3. ÎN(t) · (B(t) – 5ÊN(t)) = 4. Þ(t) x Î (t) = (enter an upper case T for Î(t), N for ÎN(t), and B for B(t))

Answers

If r(t) is the position vector for a smooth curve C, and Î (t), Ñ(t), and B(t) are unit tangent vector, principal unit normal vector, and binormal unit vector, respectively, then (1) B(t) · Î(t) = 0, (2) Þ(t) · B(t) = 0, (3) ÎN(t) · (B(t) – 5ÊN(t)) = |ÎN(t)| |B(t) - 5ÊN(t)| cos(π/2) = 0 and (4) Þ(t) x Î (t) = B(t).

(1) Since B(t) is the cross product of Î(t) and Ñ(t), it is perpendicular to both Î(t) and Ñ(t). Therefore, B(t) · Î(t) = 0.

(2) Þ(t) is the derivative of r(t), and B(t) is defined as the cross product of Î(t) and Ñ(t). Therefore, Þ(t) and B(t) are both orthogonal to Î(t). Hence, Þ(t) · B(t) = 0.

(3) ÎN(t) is the cross product of Î(t) and Ñ(t), and B(t) is also the cross product of Î(t) and Ñ(t). Therefore, B(t) - 5ÊN(t) is parallel to ÎN(t). Hence, ÎN(t) · (B(t) - 5ÊN(t)) = |ÎN(t)| |B(t) - 5ÊN(t)| cos(π/2) = 0.

(4) The cross product of two vectors is orthogonal to both of the vectors. Therefore, Þ(t) x Î(t) is orthogonal to both Þ(t) and Î(t), and hence it is parallel to Ñ(t). Therefore, Þ(t) x Î(t) is equal to B(t). So the answer is B.

To learn more about vector here:

https://brainly.com/question/29740341

#SPJ4

recipe for 36 cupcakes calls for ¾ of a cup of butter. If Rob wants to make 24 cu cups of butter does he need?

Answers

3/12 =1/4  hopefully this answer works for you

Select the correct answer.
What is the solution to |2x + 3) = 15?
O A.
О в.
O C.
O D. No solutions exist.
x = 6
x = 6 or x = -6
x = 6 or x = -9

Answers

The solution for the given equation is 6. Therefore, option A is the correct answer.

What is an equation?

In mathematics, an equation is a formula that expresses the equality of two expressions, by connecting them with the equals sign =.

The given equation is |2x+3=15.

The solution of an equation is the set of all values that, when substituted for unknowns, make an equation true.

Now, 2x=15-3

2x=12

x=6

Therefore, option A is the correct answer.

To learn more about an equation visit:

https://brainly.com/question/14686792.

#SPJ9

Write the linear equation that gives the rule for this table.
X. I Y
3. I -72
4. I -69
5. I -66
6. I -63
Write your answer as an equation with y first, followed by an equals sign.

Answers

The linear equation of the table is  y = 3x - 81.

How to represent linear equation?

Linear equation can be represented in slope intercept form as follows:

y = mx + b

where

m = slopeb = y-intercept

Therefore, let's find the slope of the table as follows:

slope = m = - 69 + 72 / 4 - 3

m = 3 / 1

m = 3

Therefore, let's find the y-intercept using (3, -72).

Hence,

y = 3x + b

-72 = 3(3) + b

b = -72 - 9

b = - 81

Hence, the equation is y = 3x - 81

learn more on linear equation here: https://brainly.com/question/30414224

#SPJ1

The double dot plot below shows the number of hours Kayla and Carmen studied during a two week period in college. Determine the most appropriate measure of variation for each data set. What is the difference between the centers?

Answers

The measure of variation include range, variance, iqr etc

What are the measure of variation

In statistics, a measure of variation is a numerical value that describes how spread out or dispersed a set of data is. The most common measures of variation are:

Range: The range is the difference between the maximum and minimum values in a data set. It gives an idea of the spread of the data, but is sensitive to outliers.

Interquartile range (IQR): The IQR is the range of the middle 50% of the data. It is less sensitive to outliers than the range.

Variance: The variance is the average of the squared differences of each data point from the mean. It measures how much the data is spread out from the mean.

Standard deviation: The standard deviation is the square root of the variance. It is a common measure of variation and indicates the typical amount that each data point deviates from the mean.

Coefficient of variation: The coefficient of variation is the ratio of the standard deviation to the mean, expressed as a percentage. It is used to compare the variation of data sets with different means.

An overview was given due to incomplete information.

Learn more about variation on:

https://brainly.com/question/18919859

#SPJ1

Analyzing a Solution
A graph titled pet treats has toys on the x-axis and bones on the y-axis. 2 lines intersect at (15, 31).

Dylan interpreted this graph of a solution and determined that the pet store gave away 15 bones and 31 toys at a recent pet adoption event.

Is his answer correct? If not, what was his mistake?
Yes, he is correct.
No, he did not use the intersection point.
No, he switched the values for the variables.
No, he needs to use the y-intercepts.

Answers

Dylan made a mistake as he switched the values for the variables.

What does the axes of Graph tells?

The graph's x-axis (horizontal line) should contain the independent variable, and the y-axis should contain the dependent variable (vertical line). At the origin, where the coordinates are, the x and y axes intersect (0,0).

Given:

We have x shows the number of toys and y axis the number of bones.

The two lines intersect at (15, 31).

As, Dylan interpreted this graph of a solution and determined that the pet store gave away 15 bones and 31 toys at a recent pet adoption event.

Dylan made a mistake as he switched the values for the variables.

Usually, 15 shows the toys and 31 shows the bones.

Learn more about Graph here:

https://brainly.com/question/17267403

#SPJ9

Calculate the covariance and correlation between the random variables X and Y. 1.0 1 1/4 1.5 2 1/8 1.5 3 1/4 2.5 6 1/4 3.0 5 1/8 Round your answers to two decimal places (e.g. 9.87). OXY=

Answers

The correlation between X and Y is -0.648, rounded to two decimal places.

First, we need to calculate the means of X and Y:

mean(X) = (1 + 1.5 + 1.5 + 2.5 + 3) / 5 = 2

mean(Y) = (1/4 + 1/8 + 1/4 + 1/4 + 1/8) / 5 = 0.15

Next, we can calculate the covariance using the formula:

cov(X, Y) = E[(X - mean(X)) * (Y - mean(Y))] = Σ[(X - mean(X)) * (Y - mean(Y))] / (n - 1)

where n is the number of data points. Substituting the values, we get:

cov(X, Y) = [(1 - 2) * (1/4 - 0.15) + (1.5 - 2) * (1/8 - 0.15) + (1.5 - 2) * (1/4 - 0.15) + (2.5 - 2) * (1/4 - 0.15) + (3 - 2) * (1/8 - 0.15)] / 4

= -0.035

Therefore, the covariance between X and Y is -0.035.

Finally, we can calculate the correlation coefficient using the formula:

corr(X, Y) = cov(X, Y) / (stddev(X) * stddev(Y))

where stddev is the standard deviation. We can calculate the standard deviations as follows:

stddev(X) = sqrt([Σ(X - mean(X))^2] / (n - 1)) = 0.8292

stddev(Y) = sqrt([Σ(Y - mean(Y))^2] / (n - 1)) = 0.0632

Substituting the values, we get:

Corr(X, Y) = -0.035 / (0.8292 * 0.0632) = -0.648

Therefore, the correlation between X and Y is -0.648, rounded to two decimal places.

For more such questions on Covariance: brainly.com/question/13487072

#SPJ4

Calculate the five-number summary of the given data. Use the approximation method.

19,2,23,25,20,2,4,8,16,11,10,12,8,2

Answers

Answer: The five-number summary of the given data is a concise summary of the main characteristics of the data set and includes the following statistics:

Minimum: 2

Q1 (first quartile), or 25th percentile: 8

Median (second quartile), or 50th percentile: 16

Q3 (third quartile), or 75th percentile: 20

Maximum: 25

Note: The approximation method involves rounding the results to the nearest whole number.

Step-by-step explanation:

Solve the equation 2x+4 1/5 =9 Explain the steps and properties used

Answers

Answer:

x = 2.4

Step-by-step explanation:

[tex]2x + 4 \times \frac{1}{5} = 9 \\ = 2x + \frac{21}{5} = 9 \\ = 5 \times 2x + 5 \times \frac{21}{5} = 9 \times 5 \\ = 10x + 21 = 45 \\ = 10x = 45 - 21 \\ = 10x = 24 \\ \frac{10x}{10} = \frac{24}{10} \\ \times = 2.4[/tex]

Can you help me solve problem #3???

Answers

The two-column method table to prove that the triangles ΔLMN and ΔLJK are similar, ΔLMN ~ ΔLJK, where LM/LJ = LN/LK can be completed as follows

Statements             [tex]{}[/tex]                         Reasons

LM/LJ = LN/LK     [tex]{}[/tex]                            Given

∠L ≅ ∠L [tex]{}[/tex]                                          Reflexive property of congruency

ΔLMN ~ ΔLJK [tex]{}[/tex]                                 SAS similarity theorem

What are similar triangles?

Similar triangles are triangles that have the same shape, and interior angles, but which may have different side lengths such that the proportion of the corresponding sides are equivalent.

The details of the reasons used to prove the similarity of triangles ΔLMN and ΔLJK can be presented as follows;

Reflexive property of congruency

The reflexive property of congruency states that a figure, such as an angle or a length is congruent to itself

SAS similarity theorem

The SAS, Side-Angle-Side similarity theorem states that if two sides in one triangle are proportional to two sides in another triangle, and the included angle between the two sides in both triangles are congruent, then the two triangles are similar.

Learn more on similar triangles here: https://brainly.com/question/24031436

#SPJ1

Mike is making macaroni salad each bowl

Answers

The numbers of cups that macaroni will he use will he use if he wishes makes 27 bowls is 9 cups.

How do we find the numbers of cups that macaroni will he use?

If Mike makes 27 bowls of macaroni salad, we can find out how many cups of macaroni he will need by multiplying the amount of macaroni needed for one bowl by the number of bowls:

= 1/3 cup of macaroni per bowl x 27 bowls

= 9 cups of macaroni

Therefore, Mike will need 9 cups of macaroni to make 27 bowls of macaroni salad.

Full question "Mike is making macaroni salad. For each bowl of macaroni salad, he needs 1/3 cup of macaroni. How many cups of macaroni will he use will he use if he makes 27 bowls of?"

Read more about numbers

brainly.com/question/25734188

#SPJ1

if the range of feasibility indicates that the original amount of a resource, which was 20, can increase by 5, then the amount of the resource can increase to 25. T/F

Answers

If the range of feasibility indicates that the original amount of a resource, which was 20, can increase by 5, then the amount of the resource can increase to 25. The statement is true.

If the range of feasibility for a given resource indicates that the original amount can increase by 5, that means the upper limit of the feasible range is 20 + 5 = 25. Therefore, the amount of the resource can increase up to 25, which is the upper bound of the feasible range.

However, it's important to note that just because the resource can increase up to 25 doesn't mean it will actually reach that level. The feasibility range only indicates what is possible or allowable based on certain criteria or constraints. Whether the resource actually increases to that level will depend on various factors such as availability, demand, and cost.

In summary, if the range of feasibility for a resource indicates an increase of 5 from an original amount of 20, then the amount of the resource can increase up to 25, but the actual increase will depend on other factors.

To learn more about range of feasibility visit: https://brainly.com/question/15700431

#SPJ4

Can you find the area of these shapes

Answers

Answer:

1. 40

2. 351

3. 49

Step-by-step explanation:

just multiply the 2 numbers!

5 times 8 is 40

13 times 27 is 351

7 times 7 is 49

(square is the same on every side so every side is 7)

(3x³-4x² + x + 7) + (x-1)

Answers

Answer:3x^3−4x^2+2x+6

Step-by-step explanation:

1).subtract the numbers

2).combine like terms

Write a function that models the data.

Answers

The function that models the data is [tex]y = 42.(\frac{1}{2})^x[/tex].

What is the formula for exponential growth and exponential decaying function?

The formula for exponential growth is [tex]y = y_0e^{(kt)}.[/tex]

The formula for exponential decay is [tex]y = y_0e^{(-kt)}.[/tex]

Let, The given exponential be [tex]y = a(b)^x[/tex] .

Now, At (0, 42).

42 = ab⁰.

a = 42.

At (1, 21).

21 = 42.b¹.

b = 1/2.

Therefore, [tex]y = 42.(\frac{1}{2})^x[/tex]is the required function.

learn more about exponential functions here :

https://brainly.com/question/14355665

#SPJ1

which pair of lines are parallel

Answers

The pairs of linear equations that are parallel are:

2 and 4.

Which pair of lines are parallel?

Two linear equations:

y = a*x + b

y = c*x + d

Are parallel if the two slopes are equal and the y-intercepts are different, then:

a = c

b ≠ d

Let's write all the lines in the slope-intercept form:

1) 4x + 3y = 15

  3y = 15 - 4x

   y = (-4/3)*x + 15/3

   y = (-4/3)*x + 5

2) 3x - 4y = -8

  -4y = -8 - 3x

     y = 2 + (3/4)x

So we can see that lines 2 and 4 are parallel.

If we rewrite line 3 we will get:

y + 1 = (4/3)*(x - 6)

y = (4/3)*x - 8  -1

y = (4/3)*x - 9

Then we conclude that only lines 2 and 4 are parallel.

Learn more about linear equations at:

https://brainly.com/question/1884491

#SPJ1

Other Questions
cognitive-behavioral therapists use all of these techniques to treat clients with obsessive-compulsive disorder except for: In the probabilistic model, increasing the service level will __________. the digital certificate on the dion training web server is about to expire. which of the following should jason submit to the ca to renew the server's certificate? The heart is an organ in the circulatory system. Muscle tissue in the heart contracts to pump blood to the body. Connective and epithelial tissues in the heart hold the muscle cells together and in place in the chest. Nervous tissue in the heart coordinates how fast and hard the muscle cells contract. renewal or modification of the cell membrane is a function of the For 3y-2x=-18 determine the value of y when x = 0, and the value of x when y = 0 what kind of slope is x = -5 What are the Bloods and Crips fighting over? artists may weld, glue, bolt, screw, nail, and wire individual pieces together to create which type of sculpture? help please see photo why is cell division important for multicellular organisms In the diagram, segment AD bisects angle BAC.Given the following segment lengths, find the value of x.Round to the nearest tenth.AB = 23AC = 18 FILL IN THE BLANK. our goal as a nation and as a society must be to free ourselves completely of the __ of racial prejudices Though dark and light phenotypes existed among the moth populations, an albino moth was recently discovered. Complete the data below in order to better understand how this may DNA = ATCG happen. Complementary rules MRNA-UAGS Dark moth - Dominant allele: DNA: TACCGTCGCATACACTGGGGTCAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC mRNA: AAS: Light moth Recessive allele: DNA: mRNA: AAS: Albino moth DNA: mRNA: AAS: - TACCGTCGCATACACTGGGGTTAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC Unknown allele: TACCGTCGCATACACTGGGGTCAGGACGAGATCGCATCCAGACGGGTCGTCGGACATGATC When responding below, be sure to use the precise terms for the mutations when appropriate. Write a claim to answer this question: What you think occurred to produce the dark and light phenotypes? Provide specific evidence from the mRNA-amino acid sequences for this claim: Propose a hypothesis as to what occurred to produce an albino moth: find the measure of CDE,BC,AB, and CAB. What do you think about Morries decision when it comes to his epitaph? (Claim, Evidence, Reasoning) What was the effect of the Second Morrill Land Grant Act of 1890?Colleges and universities for Black students were created.Rural areas received their first universities.The first university for women was founded.It founded "normal schools" for the training of teachers. Can you replace the glass plate in a microwave? in tableau, measures are automatically aggregated to the granularity of the view, and the granularity, or number of marks, is set by ____ Provide a counterexample to the following statement: The number n is an even integer if an only if 3n + 2 is an even integer.