I need help on this and the first person who answer correctly gets a BRANLIST​

I Need Help On This And The First Person Who Answer Correctly Gets A BRANLIST

Answers

Answer 1

Answer:

Look below -->

Explanation:

Similes:

-You were as brave as a lion.

-They fought like cats and dogs.

-He is as strong as an ox.

Metaphors:

-The snow is a white blanket.

-He is a shining star.

-her long hair flowed like a golden river

Personification:

-Don't sit on that chair, you're going to hurt it!

-Lightning danced across the sky

-She heard the last piece of pie calling her name

Hyperbole:

-He's running faster than the wind

-My dad will kill me if I get home late

-The shopping cost me a million dollars.

Answer 2
Similie:
She ran as fast as a cheetah
She is crabbier than a crab
She is intelligent like a chimpanzee

Metaphor:
The snow is a white blanket
He is a shining star
The calm loving waves were a mirror to your past,present, or future.

Personification:
The snowflakes danced in the air as they were gracefully falling into my warm hands.
The wind howled in the glowing night sky as I sat at the window wondering what I would do.
My alarm clock yelled at me to get out of bed. IM LATE, I howled.

Hyperbole:
We were at P.E and WOW! He’s running faster than the wind!
I carried my backpack sulking in the pain of my bag I wailed “This bag ways a TON”.
I looked at the price of the dress and oh. My. Gosh this dress will cost me an arm and a leg.

Related Questions

Poem “The wild Ducks nest”
What does colm do in paragraph 16?What can you infer about his character based on these actions
2 points plz thanks

Answers

Answer:

1. The boy was in a state of unrest as he wondered if the bird had forsaken its egg. As soon as school closed, he ran home and then to the lakeside to confirm that the bird did not forsake its egg.

2. I can infer that the boy loved animals and wanted to be guilt-free.

Explanation:

Colm was described as a young boy who loved nature and will throw stones at the lake and swim through it. It was on one of such occasions that he saw the wild duck. He was excited when he saw the egg laid by the wild duck, such that he touched it. The belief at that time was that the bird will forsake its egg when a person touched it and this was further strengthened by Paddy's exclamation when he learned that Colm touched the egg.

To allay his fears and to clear his conscience, Colm went back to the lake to confirm and when he saw two eggs laid by the bird, his guilt was gone.

help ASAP! I'll mark brainliest

Answers

Answer:

Precise Language

Explanation:

Answer is Precise language.


Clean it up immediately

To begin cleaning it up immediately











Answers

Answer:

what are your options

Explanation:

Clean it up immediately

Rewrite the metaphor below from the poem by changing it into a simile.
“the tall trees are her children,”
(No Simple Response!!!)

Answers

Answer: the trees are as tall as her children

Explanation:

as and like are simile's

Answer:

er children is as tall as the trees

Explanation

edge 2021

what is the theme for adapted from the mysterious portrait part 1

Answers

I don't knowwwwwwwwwwwwww

The Chimney Sweepers”

Answers

Answer:

The Chimney Sweeper" is a poem by William Blake, published in his 1789 collection Songs of Innocence. The poem is told from the perspective of a young chimney sweep, a boy who has been sold into labor by his father. The sweep meets a new recruit to the chimney sweeping gang named Tom Dacre, who arrives terrified. After the speaker tries to reassure Tom, Tom dreams of an angel who sets the chimney sweeps free, allowing them to play in green fields and then ascend to heaven. This dream seems to suggest that if the boys are obedient workers, they'll get into heaven. Implicitly, though, the poem takes issue with this idea, suggesting that it's a form of indoctrination for the Church. The companion poem of the same title, published in Songs of Experience, makes this position—that promises of heavenly salvation are simply a means to exploit child labor—crystal clear.

Alrighty, but what exactly is your question?

Which best describes the imagery the poet is creating in this excerpt?

The speaker goes to his bedroom door, opens the door, and finds his lover Lenore standing in the dark on the other side.
The speaker opens his bedroom door into darkness and there is nothing there so he closes the door quickly and runs back to bed.
The speaker opens his bedroom door, stands there a while, whispers into the darkness, “Lenore,” and hears this word echo softly but nothing more.
The speaker opens his door as fast as he can to run into his room, away from the scary darkness in the hallway that has no lighting.

Answers

Answer:

The speaker opens his bedroom door, stands there a while, whispers into the darkness, “Lenore,” and hears this word echo softly but nothing more.

Imagery found: Sight and Sound.

Answer: C. The speaker opens his bedroom door, stands there a while, whispers into the darkness, “Lenore,” and hears this word echo softly but nothing more.

Explanation: On Edge!

Julie of the Wolves

According to the novel's table of contents, what do the three parts of Julie of the Wolves have in common?

All three refer to wolves in some way.

All three end with the word Alaska.

Each describes a different setting.

Each focuses on a single character.

Answers

Answer:

I would say option C - Each describes a different setting.

Explanation:

Have a great day.

The three Julie of the Wolves sections shares several similarities is stated in option (C): "Each describes a different setting."

What does the story of Julie of the wolves have in common?

Jean Craighead George wrote the children's book Julie of the Wolves, which was published by Harper in 1972 and had pictures by John Schoenherr.

It takes place on the Alaskan North Slope and centers on a young Inuk girl who is forced to adapt to changes made to her society by outsiders.

A young adult book called "Julie of the Wolves" is about an Alaskan girl named Julie. A book's storyline is comprised of its introduction, middle, and conclusion.

Julie of the Wolves is divided into three distinct sections: the present, a flashback to Julie's past, and a return to the present.

Part 1: Amaroq, the wolf.Part 2: Miyax, the girl.Part 3: Kapugen, the Hunter.

As a result, option (c) is the correct answer.

Check out the link below to learn about Julie of the Wolves;

https://brainly.com/question/18160282

#SPJ2

1. Why does Circe tell Odysseus to sail closer to Scylla than Charybdis?
1
2. Describe the Sirens. What is the danger they pose?
3. Describe Scylla. What is the danger she poses?
4. Describe Charybdis. What is the danger she poses?

In your own words please

Answers

1. Odysseus chooses to sail toward Scylla rather than Charybdis because Charybdis would sink the whole ship and kill everyone

2. They are like mermaids, but they're scary and want to kill you. If they sing and you hear it, you will be put under a spell and lured to your death.

3. Scylla is a really nasty multi-headed and multi-handed sea monster. The danger is that it could eat all of them.

4. Charybdis is basically a whirlpool. The danger is that the ship could pulled inside.

hope this helps :)

Why is Visual literacy important

Answers

Answer:

Visual literacy is a set of abilities that enables an individual to effectively find, interpret, evaluate, use, and create images and visual media. A visually iterate individual is both a critical consumer of visual media and a competent contributor to a body of shared knowledge and culture.

Explanation:

Answer:

According to researchers, educators, museum professionals, filmmakers, and artists, visual literacy can improve one's creativity, critical thinking, educational achievement, empathy towards others, and ability to decipher technology

(outsiders book)
1. Which of these things is NOT one of the items Johnny brought back to
the church when he went out for supplies? *
2 poin
A. "Gone With the Wind" book
B. Pepsi
C. Loaves of bread
D. Peroxide
E. Playing cards

Answers

B Hey man hang in there we are all trying to pass to good luck

Answer:

A

Explanation:

Gone with the wind because the next morning he wakes up in the church and find a note that Johnny went out for supplies. When Johnny gets back he brings some stuff with him along with a paper copy of Gone With The Wind.

"The Mediterranean was still attacking them, wave after wave
trying to drown them..."
What figurative language is used?

A.Onomatopoeia
B.Personification
C.Simile
D.Metaphor

Answers

After reading the sentence and the options, we can say that the figurative language used is the following:

B. Personification

What is personification?

It is the figurative language that gives human traits and behaviors to inanimate objects.

For example, in the sentence, "The wind kept on singing  and the beautiful flowers danced to it," we have personification. The wind cannot really sing, and flowers cannot really dance.

The purpose of the author would be to convey the idea that the movement of the flowers in the wind was so beautiful that it reminded her of dancing.

How about the sentence in the question?

In the sentence we are analyzing here, there is personification when the author says "The Mediterranean was still attacking them." The Mediterranean is a geographical region that encompasses certain countries and a sea.

A geographical region itself cannot attack. The people who live in it can, however. The author personified the Mediterranean with the purpose of indicating the its people were the ones attacking.

Learn more about personification here:

https://brainly.com/question/24772036

Essy about friendship​

Answers

You don’t need them they aren’t nothing and won’t even be with you the rest of your life. People come and go and some leave a mark good or bad. Moral of the story friends are non existent most are fake...backstabbers.

           Friendship is the most expensive and beautiful gift one can give someone. As time passes by, lots of people will walk past, but only some stay with you forever, and those friendships will stick by one’s side through thick and thin. Lucky are those people with friends that can be trusted and wish to stay forever.

        A person acquainted with diverse people in their life might be a part of a vast friend circle, but they would depend on just one or maximum two people whom they trust to their personal space and emotions. That bond created with those special people is true friendship. There are two basic types of friendships one develops- good friends and best friends. An authentic and special bond friendship grows with the true or best friend who makes life easier and happier.

        The most crucial part of friendships is the judgment-free relationship. In a true friendship bond, a person is free of any gripping fears of judgment and can complete themselves. It makes the person feel accepted and loved. True friendship is the reason for people to stay strong in life with the assurance that their best friend is for them. A life devoid of friendship is an incomplete puzzle to keep one happy. A few have families and friends while some have lost their families, but, are backed up by friendships. Sometimes, one’s friendship becomes family. Thus, sharing a true friendship bond is a rarity.

         Friendship holds significant stature in life as it teaches unforgettable life lessons. Some valuable lessons that will change your life, how to love others apart from family, how to behave in front of people or friends. Friendships never create bad times; instead, give one the best memories to live upon. Friendships teach you to understand and trust people. Real friends will constantly motivate and cheer; sometimes, they will even direct you the paths and save you. However, one should know how to differentiate between toxic and beneficial friendships.

         Similarly, friendship teaches the importance of loyalty and reliability. There is no greater feeling in the world than a loyal, trustworthy friend by your side. However, friendship isn’t a one-way path, to experience loyalty and trust; one needs to return the mutual feelings to complete the circle of friendship. Moreover, friendships build a strong relationship bond and aids to grow. For instance, despite fights and arguments, friends set the differences aside and come back together. This teaches patience and develops a strong bond.

        Therefore, friendships are real-life connections. Real friends help each other during tough times and the difficult phases of life. They are only life-savers during a rough period, but also the best timely-advisers. True friends are the most assets of life who share the space of sorrow, happiness, and pain. They are the filler breaks of the monotonous life.

Make all exercises and questions

Answers

Answer:

2a)

1. A

2. B

3. C

4. B

5. C

B)

2. comes

3. moved

4. met

5. got married

6. got

7. was born

In the absolutely true diary of a part time Indian, How do you think Junior would feel if the other students bullied him instead of
ignoring him?

Answers

Answer:

In The Absolutely True Diary of a Part-time Indian, the protagonist Junior (Arnold Spirit) learns that his identity is worth fighting for.

What tone of voice does the leader of the thieves take while he is robbing Jonathan?​

Answers

Which book are you referring to? And if you can give me a relative page number i can tell you!!!

Visual aids should compliment what the speaker is saying. Please select the best answer from the choices provided T F

Answers

Answer:Visual Aids should compliment what the speaker is saying this is True

Explanation:

The given statement is true, that the Visual aids should compliment what the speaker is saying.

What are visual aids?

Visual aids are defined as one of the option in communication. This includes the communication by the medium of photos, graphs, video clips, and other visual components.

In addition to the written communication, visual ads give help to the written communication and that Visual aids should support the speaker's message.

Therefore, the given statement is true.

Learn more about the visual ads, refer to:

https://brainly.com/question/13130830

#SPJ2

I need help on this please

Answers

Answer:

the third one

Explanation:

Are neibours necessary nowadays

Answers

Keeping an Eye on Your Home and Family

Perhaps one of the most important benefits of getting to know your neighbors is the extra home protection. Because your neighbors know your regular comings and goings, they are more likely to notice someone lurking around. Many neighbors have thwarted thieves because they were keeping an eye on their friend’s property. Other cases include watching over your house while you’re on vacation and calling the police if something is amiss. Through neighborhood watch, you get an extra set of eyes on your home.

Enriching Your Social Life

A friendly, social neighborhood is more likely to have social events like block parties, potlucks, pool parties, game nights, and more. Close relationships with your neighbors enhance your family’s social life and create meaningful connections. A friendly neighborhood dynamic encourages you and your family to get out of the house, have some fun, and meet new people. Plus, Lincoln Military residents have access to FREE events throughout the year! Simply log in to your resident portal to see what’s going on in your neighborhood.

Lending a Helping Hand

Creating and maintaining a friendly demeanor with your neighbors can come in handy. Whether you need to borrow an ingredient for a recipe you’re trying out, or you’ve just run out of dishwashing detergent, your neighbors can save you an impromptu trip to the store. And what comes around, goes around! As a friendly neighbor, you’re happy to return the favor when the family next door needs something, as well. Show your appreciation for their giving spirit by gifting a plate of food from the recipe they helped you complete or slipping a thank you card in their mailbox.

Sharing Mutual Chores and Responsibilities

It’s especially beneficial to know your neighbors when you both share similar lifestyles, such as in military housing. For example, if you both wake up at 7:30 am to take your kids to school, you could carpool and switch off every other day. If you water your lawn weekly, you could alternate weeks and water each other’s lawns. If you’re hiring a babysitter on a Friday night, have their kids join and split the cost of the sitter. Sharing these types of responsibilities can make both of your lives more comfortable.

Making Lifelong Friends

If you have children, look for families in your neighborhood with children around the same age. Neighborhood kids can quickly become best friends, as play dates are always accessible with a simple knock at the door. Organize a neighborhood event so all the kids can meet each other and watch the friendships grow from there. This can give your kids something to do after school, on weekends, and school breaks. Instead of sitting at home and spending all their time indoors, neighborhood friendships can encourage your kids to get outside and stay active.

Providing Emotional Support  

Getting to know your neighbors is especially important in military housing. Military life can be hard to explain to someone who hasn’t experienced it. Building relationships with fellow military housing neighbors allows you to share your mutual challenges, accomplishments, and everything in between. When you need support, such as during a spouse’s deployment, you know you have a shoulder to lean on right next door. And vice versa - if your neighbor is struggling, they know they can turn to you.

At Lincoln Military Housing, we understand the importance of getting to know your neighbors, which is why we go the extra mile to facilitate these bonds. Neighborhood social events and family-friendly amenities set the stage for meeting new people and strengthening friendships. Whether you need a hand with chores or want to plan a backyard barbeque, know your neighbors for a memorable and beneficial set of relationships!

Answer:

Yes, neighbours are important....

Getting to know your neighbours comes with a wide range of benefits, including enhanced safety and community events. Whether you need to borrow an egg or need a shoulder to cry on, a good neighbour is always there to help. In both challenging and joyous times, these relationships remind you that you’re surrounded by friendship and support.

Explanation:

Here are some of the most important reasons to get to know your neighbours:

Keeping an Eye on Your Home and FamilyEnriching Your Social LifeLending a Helping HandSharing Mutual Chores and ResponsibilitiesMaking Lifelong FriendsProviding Emotional Support

Hope it helps,

Pls mark me as the brainliest'

THank you

The words drift,drive,and drum are alliterative.
True
False

Answers

Answer:

true

Explanation:

Answer:

True

Explanation:

Alliteration is the occurrence of the same letter or sound at the beginning of adjacent or closely connected words.

Using a non restrictive element rewrite the sentence. George Washington was America's first president.

Answers

Answer:

The first president of America was George Washington in 1789.

Explanation:

Which of the following is NOT true about using counterclaims?

A. A strong argumentative essay should contain primary sources and not secondary sources.
B. A strong argumentative essay should never contain primary and secondary sources.
C. A strong argumentative essay should contain primary and secondary sources.
D. A strong argumentative essay should contain secondary sources and not primary sources.
Thank chu for your help OwO!!!!

Answers

Answer:

B. A strong argumentative essay should never contain primary and secondary sources.

Explanation:

A strong argumentative essay should never contain primary and secondary sources, is an example that does not express or implies a counterclaim. Hence, option B holds true.                                

What is a counterclaim?                              

A counterclaim statement is such a statement that contains contrasting arguments regarding the subject of the statement. It should never be biased, or shall never contain one-sided opinion.            

In all the other statements given above, they mention an inclusion and exclusion of an essay, however, the second statement mentions only the exclusions of an argumentative essay.        

Hence, option B holds true regarding the significance of a counterclaim.

Learn more about counterclaim here:

https://brainly.com/question/10185591

#SPJ5

What's a good transitional phrase to end a paragraph. PLEASE HELP!!!!

Answers

Overall, Therefore, Reflecting back On,

Which option is an example of deductive reasoning?

Answers

Answer:

b

Explanation:

becuase Deductive reasoning. Deductive reasoning is a basic form of valid reasoning. ...

Answer:

b.

Explanation:

im pretty sure its b. but if I'm wrong I'm sorry

Why was Anne Frank's family hiding from the Nazis? *

A: They were Christians,

B: They were Jewish

C: Anne Frank had a physical disability.

D: They did not know what would happen in the war.

Answers

Answer:

b

Explanation:

Answer: B: They were Jewish.

Explanation:

The Nazis wanted to kill the Jews because they were blamed for the problems in Germany.

hope this helps :)

4.
Read the following passage from “Shenandoah.” Which sound device is expressed by the bolded words?

Shenandoah, I love your daughter,
Away, you rolling river,
I'll take her 'cross the rolling water,
Away, I'm bound away,
'Cross the wide Missouri.


A. rhythm


B. alliteration


C. rhyme


D. refrain

Answers

Answer:

C. rhyme

Explanation:

Why did the author leave home? Boxcar Letters Questions

Answers

Answer: She wanted to try riding the rails like her brother, and her family was having a hard time making ends meet. ... A: Her family was struggling to make ends meet, but they were better off than a lot of other families, especially since their home life wasn't unhappy. 8.

Explanation:

what's the signal from Lady Macbeth that the drunken guards have passed out?

Answers

Answer:

Lady Macbeth rings a bell when she has gotten them drunk.

"I go, and it is done; the bell invites me. That summons thee to heaven or to hell."

In Act II, scene 1

On the first day, Sarah_____________ some of her new teachers.


know

learnt

met

Answers

Answer:

met

Explanation:

read them aloud, none would make sense but met

Answer:

On the first day, Sarah met some of her new teachers.

Explanation:

Just try each of them and you see met fits.

1.
It's Not C
Read the following passage from Edgar Allan Poe’s “The Raven.” Which sound device is expressed by the bolded letters?

Once upon a midnight dreary, while I pondered,
weak and weary …
-- --

A. alliteration


B. refrain


C. rhyme


D. rhythm

Answers

Answer:

A. alliteration

Explanation:

Alliteration

Alliteration is the repetition of the same consonant sound, such as many Mondays, or dazzling dream. This type of sound repetition can occur at the beginning, middle, or end of the word.

The traditional folk song “Shenandoah” is a good example of a lyric poem. It does not tell a story, but it does express the writer’s feelings.

Shenandoah

Shenandoah, I long to hear you,

Away, you rolling river,

Oh, Shenandoah, I long to hear you,

Away, I’m bound away,

‘Cross the wide Missouri.

Shenandoah, I love your daughter,

Away, you rolling river,

I’ll take her ‘cross the rolling water,

Away, I’m bound away,

‘Cross the wide Missouri.

Shenandoah, I long to hear you,

Away, you rolling river,

Oh, Shenandoah, I long to hear you,

Away, I’m bound away,

‘Cross the wide Missouri.

Refrain

A refrain is a line or group of lines repeated throughout a poem. A refrain can be

a line or two of verse that comes at the end of a stanza; or

a stanza that is repeated regularly throughout the poem.

In musical terms, the repeated lines sung after a stanza are called a chorus.

Rhythm

To put it into musical terms, rhythm is the beat of poetry. Because there is no drum or bass to define the beat of a poem, it is done through the choice and arrangement of words.

As you know, certain words or syllables of words are stressed when you speak. The pattern of stressed words and syllables found in a lyric poem helps build its rhythm. The rhythm pattern in poetry is called meter.

Before you go on, try this little exercise. Think of your favorite song again. Write the first verse of lyrics down on paper. Now, here is the hard part. Try to forget the music that the lyrics are set to and speak the words as a poem.

As you do so, underline the syllables that are stressed. This will show you the rhythm within the words, not just in the sound of the music. When you are done, you will have analyzed a piece of poetry for rhythm.

Rhyme

As you know, words that rhyme end with a similar sound. Rhyme and time, beat and heat, and friends and trends are all examples of rhyming words.

“Mary Had a Little Lamb” has only two rhyming words. Both come at the end of a line of verse.

As in rap lyrics, the use of rhyming in lyric poetry can be very elaborate. As you will see in “The Raven,” rhyming words can come at the end of lines of verse (end rhyme), or they can be located within one or more lines of verse (internal rhyme).

Other Questions
7. Find the inverse of f(x) = -2x + 10. Please show work. Which is NOT a type of crowd?ConventionalO FormativeO CasualO Expressive A slide at a children's park is 74 inches tall in the horizontal distance The slide covers is 70 inches what is the angle measures created by the slide and the ground a cyclist covers a distance of 15km in 2hours calculate his speed Who suspects Macbeth of foul play? 6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located?