How did French Entitlement thinkers Baron de
Montesquieu and Jean-Jacques Rousseau influence the
colonists (and the Founding Fathers)?

Answers

Answer 1

Answer:

Explanation:

He basically advocated direct democracy. When Rousseau wrote the Social Contract, there was not a society in the world with such a system. His vision of equality, popular participation in government, and promotion of the general welfare, however, was shared by American colonists and others.


Related Questions

Level F Iready After the museum for African
American history was proposed,
what was the first step toward its
creation?
The government selected a place to
locate the museum.
The veterans supplied the money to
build the museum.
The president signed a law to approve
the museum.

Answers

The first step toward the creation of the National Museum of African American History and Culture was the approval of a law by the President of the United States.

How did Bush make this happen?

In 2003, President George W. Bush signed the National Museum of African American History and Culture Act, which established the museum as a part of the Smithsonian Institution and authorized federal funding for its construction.

The act was a significant step towards the creation of the museum, as it provided the legal framework and funding necessary to begin the process of building and opening the museum.

Read more about African American history here:

https://brainly.com/question/14307974

#SPJ1

Answer: the president signed a law to approve to the museum

Explanation:

How did the state of Georgia contribute to the United States during World War II?

Answers

Georgians responded to their country's call as the United States prepared for World War II. Georgia more than any other Southern state played a crucial role in the war effort during World War II (1941–1945).

Georgians made up more than 300,000 members of the armed forces, while numbers of civilians engaged in the quickly developing wartime industries.

While 320,000 Georgians participated in the American armed forces, tens of thousands of Georgians laboured at home during the war to build B-29 bombs, repair aircraft, and work in shipyards.

The Second World War, lasted from 1939 to 1945 and was a global battle. The vast majority of nations in the world, including all of the great powers, took part in the war as members of the Allies and the Axis, two diametrically opposed military coalitions. The line between civilian and military resources was blurred as many parties pushed their economic, industrial, and scientific powers behind this all-out conflict.

To know more about World War II, click here:

https://brainly.com/question/1449762

#SPJ4

If you are elected as a US representative, what laws would you propose?

URGENT

Answers

Answer:

If I was elected as a US representative, I would propose a law that forbids bias on race, which means certain races don't get benefits, and certain races aren't required to achieve more than others do.

Answer:

well, think about what matters most to you, what you want to see in this country, and then propose a law.

HELP PLS>> What is another for the nile river??

Answers

Answer:Al-Nīl

Explanation:

What was one major problem for free African Americans in the early 1800s?
A. Most states banned them from entering.
B. They had to live on plantations with enslaved people.
C. They were not allowed to get married.
D. Many landlords refused to rent them homes.

Answers

ANSWER : D If they were freed slaves we can rule out B I’m fairly positive A is incorrect C is incorrect

when johannes gutenberg invented his printing press in the mid 1400s, what was the first book he printed?

Answers

The only book that Gutenberg published was a Bible, which was published in 1452. The 1,300-page Gutenberg Bible is thought to have been printed 180 times, up to 60 of them on vellum. The text on each page of the Bible was 42 lines long, double-columned, and certain letters were colored.

For the Bible, Gutenberg utilized 50,000 sheets of paper and 300 distinct molded letter blocks. There are several remaining book fragments. The vellum version has four entire copies, while there are 21 complete copies of the Gutenberg Bible.

Fust foreclosed on Gutenberg in 1455. All of Gutenberg's tools were given to Fust and a former calligrapher from Gernsheim, Germany, in a subsequent litigation.

know more about Bible here

https://brainly.com/question/23570286#

#SPJ4

In a 125-word paragraph, explain how the introduction of MTV and sitcoms challenged traditional values and ideas in the 1980s.

Answers

The introduction of MTV and sitcoms of the 1980s challenged traditional values and ideas in several ways. MTV challenged traditional music stripes and introduced new pop culture ideas and lifestyles into American homes.

With its edgy music videos, fashion statements, and celebrity culture, MTV blurred the lines between different social classes and challenged traditional gender places, making it a media outlet that numerous parents lowered upon. Sitcoms also challenged traditional values and ideas, frequently depicting non-traditional family structures characters. These shows helped to normalize different cultures, breaking down conceptions and easing acceptance of diversity. With the preface of MTV and sitcoms.

The 1980s marked the birth of a new period of entertainment in America, one that challenged traditional values and ideas and presented a broader range of times and perspectives.

To learn more about MTV and Sitcoms:

https://brainly.com/question/22660635

#SPJ1

who is travis alexander

Answers

Travis Alexander was an American salesman, motivational speaker, and author.

He is best known for his murder in 2008, for which his previous girrlfriend,  was convicted. Alexander was born on July 28, 1977 in Riverside, California and was raised in a Mormon family.

He worked as a salesman for the multi-level marketing company Pree-Paid Legal Services and also gave motivational speeches.

Alexander was found dead in his home in Mesa, Arizona on June 9, 2008, having been sttabbed multiple times, shot in the head, and had his throatt slit. Arias was arrested for the murrder and was convicted in 2013. She is currently serving a lifee sentence in prison.

To know more about Legal Services click on below link:

https://brainly.com/question/21852002#

#SPJ11

The federal system outlined in the new constitution contained
A.only an executive, who was elected by all the people.
B.one main center of power, with three subsidiary branches that can make suggestions.
C.two branches, with both branches having equal power.
D.three branches, in which each branch has the power to restrain the other branches.

Answers

The federal system outlined in the new constitution contained three branches, in which each branch has the power to restrain the other branches.

The United States Constitution, which was ratified in 1787, established a federal structure with three departments of government: the legislative, executive, and judicial. Each branch is intended to have distinct authority and accountability, as well as to function as a check and balance on the others.

Making legislation belongs to the legislative branch, usually known as Congress. The President is the leader of the executive branch, which is in charge of running the government's daily operations and executing the law. The Supreme Court and other federal courts make up the judicial branch, which is in charge of applying the law and preserving the Constitution.

Each branch has the authority to impose limitations on what the other branches can do. For instance, a veto from the president can be overridden by the legislative branch, laws approved by Congress can be vetoed by the executive branch, and laws can be declared illegal by the judicial department. This system of checks and balances guarantees that the government functions in a balanced and democratic way and prevents any one branch from becoming overly strong.

For more questions on federal system click on

https://brainly.com/question/985210

#SPJ4

what did the germans celebrate before groundhog day

Answers

The Germans observed Candlemas as "Badger Day," believing that if a badger came out of its lair on a sunny day and cast a shadow, it would indicate that there would be four more weeks of winter.

In German-speaking areas, the animal associated with forecasting the weather is the badger (Germans:dachs) In this instance, it appears that the custom that clear skies on the Christian holiday of Candlemas herald a protracted winter has been strengthened. Punxsutawney, Pennsylvania, hosts the most well-known Groundhog Day event, which is centred on the semi-mythical Punxsutawney Phil. The Grundsow Lodges in Pennsylvania Dutch Country, in the southeast of the state, also participate in the festivities. Other localities throughout the United States and Canada have also adopted the event. They are all surrounded by weather legends, which were crucial to German agriculture. But the Lostags are not well known to contemporary Germans.

To learn more about Groundhog day click here

https://brainly.com/question/30504429

#SPJ4

What was Soviet Union command economy?

Answers

Answer:

The Soviet command economy coordinated economic activity through the issuance of directives, by setting social and economic targets, and by instituting regulations. Soviet leaders decided on the state's overarching social and economic goals.

Explanation:

In The Federalist No. 10, James Madison argued that factions in a republic are

Answers

In The Federalist No. 10, James Madison argued that "the most common and durable source of factions has been the various and unequal distribution of property."

Federalist Number 10s were optimistic about the central government's ability to do its duty in what was then a small and complex country. The essay suggests that the founders did not foresee the ill effects of rent seeking, corruption, and oppression of minorities, nor did they foresee the calamities associated with slavery. The essay questions the role of government as a party machine, business, political process, and contractor, and explores a variety of contemporary theories explaining government effectiveness.

To know more about Federalism click on the link below.

https://brainly.com/question/28966296

#SPJ4

according to confucius, which of type of work was valued most. a. mental work b. physical work c. religion work D. computer work

Answers

According to Confucius, religion work was valued most. Thus option (C) is correct.

What is a Religion?

A religion is a compilation of certain beliefs, practices, and rituals that are propagated by a particular group of people. A religion has some cultural beliefs, customs, method of prayer or worship, certain scriptures, symbols, festivals which the people follow.

In the world, there are many religions. The customs and practices which are followed in a religion is based on the place and its geographical and climatic conditions in which that religion has started.

According to Confucius, religion work was valued most. Therefore, option (C) is correct.

Learn more about religion here:

https://brainly.com/question/4791540

#SPJ9

According to Confucius, religion work was valued most. Therefore, option (C) is correct.

where we can find the cold war: a world history odd arne westad

Answers

"Cold War: A World History" by Odd Arne Westad is a book that can be found at a variety of bookstores, both physical and online. It is widely available for purchase or order at major book retailers such as Amazon, Barnes & Noble, and Waterstones, as well as at many independent bookstores.

In addition to purchasing a physical copy of the book, "Cold War: A World History" may also be available in digital formats such as e-book and audiobook. These formats can be purchased through many online retailers as well, including Amazon Kindle, Apple Books, and Audible.

Finally, if you prefer to borrow books instead of purchasing them, "Cold War: A World History" may also be available at your local library. You can check the library's online catalog or speak to a librarian to see if the book is available to borrow.

Learn more about "cold war" here:

https://brainly.com/question/12698715

#SPJ11

the date range of the beginning of the civil war era and the end of the reconstruction era are:_____.

Answers

The beginning of the Civil War era is typically dated to the year 1861, when several southern states seceded from the Union in response to the election of Abraham Lincoln as President of the United States.

The actual war lasted from 1861 to 1865, with the Union emerging victorious over the Confederacy.The end of the Reconstruction era is usually dated to 1877, when the last federal troops were withdrawn from the southern states, effectively ending the period of Reconstruction that followed the Civil War. During Reconstruction, the federal government attempted to rebuild the southern states and promote civil rights for African Americans, who had been freed from slavery by the 13th Amendment to the Constitution.The period between the end of the Civil War and the end of Reconstruction was marked by significant social, economic, and political changes in the United States, particularly in the South. The end of Reconstruction also marked the beginning of a new era of segregation, discrimination, and racial violence in the South, as many white southerners sought to reestablish their dominance over African Americans.

To learn more about Civil War click the link below:

brainly.com/question/11874600

#SPJ4

What is iniquity in the Bible means?

Answers

In the Bible, iniquity refers to immoral or unjust geste , especially, the breach of God's law or commandments. Iniquity is constantly applied interchangeably with lawbreaking, still it typically implies a further planned and willful breach of God's laws.

The Hebrew expression for iniquity," avon," is used in the quaint testament to explain a expansive range of immoral or unjust actions, similar as deification, violence, thievery, and sexual immorality. in the New testament, the Greek word for iniquity," anomia," is regularly used to explain lawlessness or the rejection of God's laws.

Iniquity is constantly appertained to in the Bible within the environment of God's judgment and discipline for sin. still, the Bible also emphasizes God's mercy and remission for individualities who rue and pull down from their iniquity.

Learn more about Bible:-

https://brainly.com/question/434489

#SPJ4

how was the cold war bewteen the united states and the soviet union impacted by the formation of the north atlantic treaty organization (NATO) and warsaw pact?

Answers

Significant impact on the Cold War between the United States and the Soviet Union. Here are some key ways in which these alliances influenced the Cold War:

Military balanceIncreased tensions

Ways in which these alliances influenced the Cold War

Military balance: The formation of NATO and the Warsaw Pact led to a military balance between the two superpowers. NATO was established by the United States and its allies in 1949 to provide collective security against Soviet aggression. In response, the Soviet Union and its allies formed the Warsaw Pact in 1955 to counter the threat posed by NATO. The establishment of these two alliances led to a military standoff between the two superpowers that lasted for decades.

Increased tensions: The creation of NATO and the Warsaw Pact increased tensions between the United States and the Soviet Union. The existence of these military alliances gave the impression that both sides were preparing for war, which created a climate of fear and suspicion.

Arms race: The creation of NATO and the Warsaw Pact also fueled the arms race between the United States and the Soviet Union. Both sides engaged in a massive buildup of nuclear weapons and other military hardware in an attempt to gain an advantage over the other.

Learn more about Cold War at:

https://brainly.com/question/25774915

#SPJ1

Which of the following is an example of using physical capital resources to
save time and money?

Answers

An example of using physical capital resources to save time and money is building extra space in a factory to simplify production. Thus the correct option is A.

What are capital resources?

The resources in any business which is used to start a business is called capital resources. The physical capital resources are those which can be seen or touched like land, building, machinery, and so on.

The materials used in the production of a good or service are known as factors of production. Building additional space in a factory can help streamline production, which makes it easier to produce large quantities of goods.

Therefore, option A is appropriate.

Learn more about capital resources, here:

https://brainly.com/question/2609674

#SPJ1

The complete question is Probably

Which of the following is an example of using physical capital to save time and money?

-building extra space in a factory to simplify production

-switching from oil to coal to make production cheaper

-lowering workers' wages to increase profits

In Roe v. Wade, the Supreme Court drew on legal groundwork laid in
, a case about
. The Roe decision stated that
were protected by the Constitution.

Answers

The Supreme Court addressed the abortion issue in the case of Roe v. Wade by referring to the US Constitution.

Describe Roe v. Wade.

The well-known legal dispute that took place in the United States in 1973 is known as Roe v. Wade.

The US Supreme Court concluded in this case that a pregnant woman's right to seek an abortion is protected by the US Constitution and is not subject to excessive government limitations.

Due to the aforementioned, the Supreme Court invalidated numerous abortion-related federal and state legislation.

Additionally, various inquiries on the subject were raised, including:

Should abortion be legal? What circumstance?

Who should have the authority to rule on abortion law?

To learn more about Supreme Court of Justice in: https://brainly.com/question/6295375

#SPJ1

What Impressionist convention did Renoir use in Le Moulin de la
Galette?
Renoir made sketches from photographs before
painting the final version.
Renoir created idealized figures, based on classical
conventions.
Renoir depicted a dance hall, a modern-day leisure
activity.
Renoir used smooth brushstrokes and a soft. muted
color palette

Answers

Answer:

C. Renoir depicted a dance hall, a modern-day leisure

activity.

Explanation:

I took the test :)

What did Fred Astaire Jr do for a living?

Answers

Fred Astaire Jr was an actor and dancer who did television shows and films, as well as performing in stage productions for his livings.

He was the son of the legendary dancer and actor Fred Astaire. He followed in his father's footsteps and pursued a career in show business, focusing mainly on dance and choreography.

He was best known for his roles in films such as That's Entertainment! and The Towering Inferno. He also choreographed for Hollywood films, Broadway shows, and television specials.

He received an Emmy Award for his choreography in the television special Ann Margret: Hollywood, Music, and Memories. He also wrote an autobiography, Steps in Time, in which he discussed his life and career.

To know more about Emmy Award click on below link:

https://brainly.com/question/30169010#

#SPJ11

Which statement expresses a frame of reference in the United States in the nineteenth century?


A) The idea that the United States had the right to expand westward was called Manifest Destiny.

This also contributed to the events that caused the Mexican War in 1846. When the United States annexed Texas in 1845.

Mexico viewed this as an act of aggression against them and ended diplomatic relations with the U.S.

B) The US claimed that the border between the US and Mexico was at the Rio Grande, whereas Mexico claimed that the border was at the Nueces River.

C) President James K. Polk ordered General Zachary Taylor and his troops to the north bank of the Rio Grande.

D) The US declared war on Mexico on May 13, 1846.

Answers

The statement expresses a frame of reference in the United States in the nineteenth century is the idea that the United States had the right to expand westward was called Manifest Destiny.

What is Manifest Destiny and what did it cause?

A common notion in the United States during the 19th century was that it was the country's duty and destiny to advance westward and disseminate democracy and civilization throughout the continent. This idea propelled the United States' westward expansion, which led to the conquest of states like Texas, California, and Oregon and ultimately sparked the Mexican-American War. Nationalism, idealism, and economic motivations all played a role in the development of Manifest Destiny. Many Americans thought that the country would eventually grow, and this idea was used to justify things like war, the eviction of Native Americans, and territorial expansion. The Mexican-American War was sparked by Manifest Destiny's tensions with Mexico, which also fueled divisions between the North and South over whether newly conquered territories should be considered part of the United States.

To Know more about Manifest Destiny Visit:

brainly.com/question/11669373

#SPJ1

Answer: The idea that the United States had the right to expand westward was called Manifest Destiny.

Explanation: the answer for edmentum

who is the youngest person to sail around the world

Answers

The youngest person to sail solo around the globe was a Dutch sailor named Laura Dekker.

At the age of 16, she achieved this achievement in 2012. She left the Netherlands and travelled across the Atlantic, Indian, and Pacific Oceans before sailing back to her country. Storms, engine problems, and equipment failure were only a few of the difficulties she encountered during her voyage. She also had to deal with the criticism of many who thought it was inappropriate for someone her age to embark on such a perilous trek. She managed to complete her voyage and solidify her position in history despite all the challenges.

NOTE: Jessica Watson is an Australian sailor who attempted to sail solo around the world in 2009. At the time, she was 16-years-old and attempted to break the record for the youngest person to do so. However, she was unsuccessful in her attempt as she was forced to turn back due to engine failure. Although she was unable to break the record, she is still considered an amazing sailor and is an inspiration to many.

For more questions on Dutch sailor click on

https://brainly.com/question/9795968

#SPJ4

What did Horace Greeley do in reconstruction?

Answers

Horace Greeley advocated for leniency and amnesty towards former Confederates during Reconstruction.

Horace Greeley was a prominent American newspaper editor, founder of the New York Tribune, and political figure during the 19th century. In the aftermath of the Civil War, he advocated for leniency and amnesty towards former Confederates, arguing that harsh punishment and continued military occupation of the South would only prolong the conflict and exacerbate tensions between North and South.

Greeley also believed in equal rights for African Americans and supported Reconstruction efforts aimed at securing their political and social rights. While his views on Reconstruction were not universally shared, Greeley's influence as a public figure helped shape the debates and policies of the era.

Learn more about "Horace Greeley" here:

https://brainly.com/question/28320921

#SPJ11

Why was Wudi called the Martial Emperor?

He had army officers run the government.
He encouraged soldiers to protect rebels.
He designed new weapons for the military.
He developed and maintained a strong military.

Answers

D) he developed and maintained a strong military

What story does Casca relate to Brutus and Cassius? What does Casca tell us by the personal remarks he adds to the story?

Answers

Casca relates the story of Caesar refusing the crown 3 times. Casca informs Cassius that the senators plan to make Caesar king in the Senate the next day.

Cassius draws his dagger and swears to the gods that if he can make a weak man like Caesar so powerful, he can give Cassius a chance to defeat the tyrant. He declares that Rome will be nothing more than rubbish or rubbish, as it is liable to be burned by Caesar. Casca joins Cassius in accusations against Caesar, and Cassius reveals that he has already convinced many powerful Romans to support the resistance movement.

To know more about Julius Caesar click on the link below.

https://brainly.com/question/12296618

#SPJ4

For which reason did Persia attract foreign interest in the early 1900s?A. Oil was discovered in Persia. B. Persia offered very favorable trade agreements. C. Persia had a multitude of untapped natural resources.
D. Persia offered very favorable trade agreements.

Answers

Persia (now Iran) attracted foreign interest in the early 1900s primarily because of its vast oil reserves. The first significant oil discovery in Persia was made in 1908, which attracted the attention of British and Russian investors.

As a result, foreign companies started to invest heavily in Persia's oil industry, leading to the formation of the Anglo-Persian Oil Company (now known as BP) in 1909.The discovery of oil in Persia had far-reaching consequences for the country's economy and politics. The oil industry quickly became the dominant sector of the economy, providing Persia with a new source of revenue and wealth. However, the involvement of foreign powers in the country's oil industry also created political tensions, as some Persians felt that they were being exploited by foreign companies.In addition to oil, Persia also had a range of untapped natural resources, such as copper, lead, and zinc. However, these resources were not fully exploited until later in the 20th century. Persia did offer some trade agreements, but they were not as favorable as other countries in the region.In conclusion, the discovery of oil was the primary reason for foreign interest in Persia in the early 1900s. The oil industry provided Persia with significant wealth but also created political tensions due to foreign involvement in the country's affairs.

To learn more about foreign click the link below:

brainly.com/question/30540238

#SPJ4

What is militarism in World War 1?

Answers

Militarism was one of the major causes of World War 1. It is a political ideology that emphasizes the importance of a strong military and the use of military force to achieve national goals and objectives.

In the years leading up to World War 1, many European countries, including Germany, Austria-Hungary, and Russia, were engaged in a military arms race, with each nation attempting to build up its military strength in order to assert dominance and influence over other nations. This led to a buildup of weapons and armies, and tensions between these countries increased as a result.

Militarism also played a role in the outbreak of World War 1 by shaping the way that countries approached international diplomacy and conflict resolution. Many political leaders in Europe at the time believed that military force was the most effective way to resolve disputes, and this led to a willingness to use force in order to achieve national goals.

For such more question on  Militarism

https://brainly.com/question/289116

#SPJ4

Identify the countries on the map that made up the axis powers during world war ii.

Answers

The three principal partners in the Axis alliance during World War II were Germany, Italy, and Japan.

In the World War II, there were two major form of alliances the Axis alliances and the Allied alliance. The three principal partners in the Axis alliance were Germany, Italy, and Japan and these countries were led by German dictator Adolf Hitler, Italian dictator Benito Mussolini, and Japanese Emperor Hirohito. The alliance was formalized in September 1940 through the Tripartite Pact. The other countries that subsequently joined the alliance were Bulgaria, Croatia, Hungary, Romania, and Slovakia.  

The Allied alliances were led by Great Britain, the United States, and the Soviet Union under the leadership of British Prime Minister Winston Churchill, US President Franklin D. Roosevelt, and Soviet Premier Joseph Stalin. The alliance was formalized by signing the Declaration by United Nations on January 1, 1942.

Learn more about Axis alliance:

https://brainly.com/question/613408

#SPJ4

great systems of ________ are the hallmark of great civilizations.

Answers

Great systems of Governance are the hallmark of great civilizations.

What is civilizations?

Civilizations are complex societies that possess a high level of cultural, social and political organization. They usually have a writing system, an organized government, a system of laws, and a hierarchical social structure. Civilizations have a complex system of beliefs, values, and practices that are shared by a large number of people. They also have developed ways of managing resources and resolving conflicts. The development of civilizations was a long and gradual process that began in the Neolithic period with the emergence of sedentary communities and the adoption of agriculture. Throughout history, civilizations have risen and fallen, and many of their achievements have been lost. However, their legacy can still be seen in the modern world.

To learn more about civilizations
https://brainly.com/question/17205693
#SPJ4

Other Questions
a recursive function is a function that: group of answer choices calls itself, directly or indirectly. returns a double. is inside of another function. takes 3 arguments. Question 1What is power, and what is its relationship to voltage and amperage? Cyanide binds and impairs one of the molecules involved in the production of ATP. Which organelle does cyanide act upon? what is the velocity of a rock if it falls at a 3m/s Three basic team member types exist within a typical Six Sigma Project Team; ________ members provide expert information, council, or help in accessing resources when called upon by the project team leader, ________ members participate in all activities of the team and attend as many team meetings as possible, and ________ members provide expertise on an as-needed basis as subject matter expertsa. resource, regular, ad hocb. regular, resource, ad hocc. ad hoc, resource, regulard. ad hoc, regular, resource. if we change the constraint quantity to a value outside the sensitivity range for that constraint quantity, the shadow price will change. What are the most common restaurant food safety risks? Multiple Select QuestionSelect all that applySelect all the statements that correctly describe organometallic reagents.A.Organometallic reagents are good nucleophiles and strong bases.B.Organometallic reagents are ionic since they contain a bond between a metal and a nonmetal.C.Organometallic reagents are a source of electrophilic carbon.D.These reagents contain a polar carbon-metal bond. If you showed a 2-year-old that you'd hidden a toy behind the bed in a model of her bedroom, she would not be able to find the toy in her real bedroom because she lacksanswer choicesO analytical thinking.O random thinking.O critical thinking.O schematic thinking.O egocentric thinking. what did george washington believe was the proper solution to the indian problem? he piece of DNA written below was found by an undergraduate researcher while examining a novel bacteria strain. Show the undergraduate researcher what the doublestranded DNA would look like for this single strand of DNA. Make sure you show all important chemical components that describe DNA orientation.5 GGCGAATCATGCGCTGCCTTGTTTCCACTAGTAGACGCGGGACTTGGTTTCACACATGACGCGT An instructor grades on a curve (normal distribution) and your grade for each test is determined by the following where S = your score. A-grade: Su + 20 B-grade: u + OSS< + 20 C-grade: u-OSS What is energy efficiency in dishwater? Write an algebraic expression to represent the following situation: "Greg has nickels and pennies in his pocket. The number of pennies is 7 less than twice the number of nickels. Let N represent the number the nickels. Write an expression for the number of pennies." 3. Which is the first step in setting a financial goal? who moved my cheese summary PART THREE: LESSON 07.04 INTRODUCTIONS IN ARGUMENT WRITINGSubmit the introductory paragraph of seven to 10 sentences. Be sure to include your claim and briefly mention the counterclaim.Can a PSA help reduce the number of distracted driving incidents? PSA are useful in decreasing driving incidents, they let the audience see for themselves the awful impacts of texting and driving. PSA prove and repeat the audience to not text and drive. Here is a graph of F and G. 1. Describe three goals of the NewDeal. What is the approximate area of the geometric figure?ResponsesA 10 square units10 square unitsB 8 square units8 square unitsC 5 square units5 square unitsD 2 square units2 square unitsE 3 square units