donald buys a subscription to a national magazine that gives him two years for the price of one year. after the two years expire, donald continues to receive the magazine for six more months, although he has not subscribed again. the magazine then sends donald a bill for the magazines he received after the expiration of his subscription. donald:

Answers

Answer 1

Option (a), The publication then sends Donald a charge for the publications he got after his subscription expired. Donald is not obligated.

The meaning of a cancelled subscription

A subscription that has expired is one that has expired. When a customer chooses to stop paying for anything at the next payment date or at the end of the current term, that decision is referred to as canceling a subscription.

What is the grace period for subscriptions?

If the user is recovered during the first 28 days, the current billing date is retained. If the subscriber is retrieved during this grace period, neither the subscriber's paid service days nor your subscription revenue will be impacted.

Subscriptions would they be active if you get a new card?

If you already have a recurring charge and switch to a different payment method, the repeating charge is not immediately transferred to the new card. To switch the payment method for your membership, you must stop your current recurring payment and begin a new subscription with your new card.

Learn more about grace period: https://brainly.com/question/15698949

#SPJ4

Donald buys a subscription to a national magazine that gives him two years for the price of one year. after the two years expire, Donald continues to receive the magazine for six more months, although he has not subscribed again. the magazine then sends Donald a bill for the magazines he received after the expiration of his subscription. Donald:

(a) is not obliqated

(b) is obligated


Related Questions

when negative externalities occur as a result of a product market's activity, the market will ____ than is desirable.

Answers

When negative externalities occur as a result of a product market's activity, the market will produce more than is desirable.

Negative externalities are costs imposed on society that are not reflected in the market price of a good or service. These costs can include things like pollution, traffic congestion, or other environmental impacts.

When the market price does not reflect these costs, the result is a "market failure," where the market produces more than is socially desirable. In other words, the market does not take into account the full cost of production, so firms will produce more goods and services than they would if they had to pay for the full cost of their actions.

This leads to an overallocation of resources to the production of the good or service in question, and a corresponding underallocation of resources to other, more socially beneficial activities.

Learn more about negative externalities here:

https://brainly.com/question/24171158

#SPJ4

top executives at bbt corporation set the strategic direction for the firm at corporate headquarters. bbt's local managers are then informed of these strategies and given complete freedom to implement them. which of the following management functions best describes the freedom provided local managers?

Answers

The management function that best describes the freedom provided to local managers at BBT Corporation is "organizing". So, the correct option is B.

Organizing is the management function that involves arranging resources, people, and tasks to achieve the desired goals. In this case, the top executives at BBT Corporation set the strategic direction for the firm at corporate headquarters, and local managers are informed of these strategies and given complete freedom to implement them.

This means that the local managers are responsible for organizing the resources, people, and tasks within their respective areas of responsibility to achieve the company's goals.

By providing local managers with complete freedom to implement the strategies, the top executives are delegating the responsibility of organizing the resources, people, and tasks to the local managers.

This allows the local managers to use their knowledge and expertise to make decisions about how best to organize their areas of responsibility to achieve the company's goals.

In summary, the freedom provided to local managers at BBT Corporation is related to the management function of organizing, as they are responsible for arranging resources, people, and tasks within their respective areas of responsibility to achieve the company's goals.

To learn more about management click on,

https://brainly.com/question/14734818

#SPJ4

Complete question is:

Top executives at bbt corporation set the strategic direction for the firm at corporate headquarters. bbt's local managers are then informed of these strategies and given complete freedom to implement them. which of the following management functions best describes the freedom provided local managers?

a) planning

b) organizing

c) decision-making

d) Leading

Adjustment for Accrued Revenues
At the end of the current year, $14,780 of fees have been earned but have not been billed to clients.
Journalize the adjusting entry to record the accrued fees. If an amount box does not require an entry, leave it blank.
Accounts Receivable 14,780 (D), Fees Earned 14,780 (C)

Answers

The year end adjustment journal entry for unrecorded fees revenue will be as follows:  Accounts Receivable A/c Dr. is $14780 and To Accrued Revenue is $14780.

Accrued revenue refers to the revenue that a company has earned but has not yet received payment for. This typically occurs when a business provides goods or services to a customer on credit, with payment expected at a later date. In such cases, the company records the revenue as earned and records it in their financial statements, even though the payment has not yet been received.

Accrued revenue is a crucial aspect of a company's financial records, as it allows for a more accurate representation of the company's financial health. It also provides an insight into the company's cash flow, indicating that a certain amount of cash will be received at a later date. It is essential for companies to keep track of accrued revenue, as it affects the company's financial statements, such as the balance sheet and income statement.

To learn more about Accrued Revenue visit here:

brainly.com/question/4051749

#SPJ4

Complete Question:-

Adjustment for Accrued Revenues At the end of the current year, $14,780 of fees have been earned but have not been billed to clients. Journalize the adjusting entry to record the accrued fees. If an amount box does not require an entry, leave it blank.

question content area angela is frustrated that you keep asking her more questions about the photographer, but when you meet chris reminds her that he expects the photographs in both print and digital format. this is not included in the packages that you suggested, but another photographer can provide them for a higher fee. you were right to keep probing for more detailed acceptance criteria on her requirements. the photography goes well, and the couple gets the photos they want in both formats. it is now four months before the wedding. you move through your planning worksheet and meet with chris and angela to plan the catering. you break the original wbs item into more detailed tasks. you arrange meetings to interview caterers and to sample their food. angela selects one that you have not used before, but who has good reviews. the food is excellent, and the price fits the budget. the caterer sends angela an email outlining a tentative menu and pricing. she asks angela to reply to confirm their contract, with an agreement to meet again three weeks prior to the wedding to finalize headcount and any last-minute menu changes. what do you suggest that angela do before confirming the contract? A. you and angela get another reference who had a good experience with this caterer. B. angela copies the activity list from your plan into her email and commits to the order contingent on the caterer confirming her agreement to those tasks. C. you want another meeting with the caterer to discuss exactly what they will and will not do on the wedding day. D. you have already agreed on the menu, pricing, and the task list. E. you assume they will complete their work as customary in your area. F. the couple questions why you insist on yet another meeting, but ultimately agree.

Answers

The cost of commodities serves as a prominent example of a stagnating economy. In this case, we suppose that the price is determined by the same-era dynamics of supply and demand. Price, demand, and supply all apply to the same time frame.

What is meant by Statics?

If two variables are functionally related and their values reflect the same time period or point in time, the analysis is said to be static.

To put it another way, static analysis or static theory is the study of static relationships between pertinent variables. The main objectives of statistics for economics are the gathering, processing, and assessment of particular economic data.

Therefore, It shows relationships among several factors, including as output, pricing, demand, and supply, among others, which helps us understand and analyse economic theories.

Learn more about statics here:

https://brainly.com/question/26609519

#SPJ1

the sales projections for travel-space trailers appear to be valid and reasonable. the company has researched the market and has determined the potential demand for their products. the demand for travel-space trailers company products is high. the company has a good reputation and their products are well-made. the market for their products is good, and they have a lot of repeat customers. according to fessler

Answers

According to marketing strategy, "the market plan for the product is inadequate" is one of the four typical reasons why new products may fail.

Business markets are the markets where transactions between businesses take place, to put it simply. In such markets, one company sells its goods to clients who do not ultimately make use of the goods' benefits but rather utilize them to produce new benefits. In the example provided, a corporation is buying a product from another company to incorporate into a different product. As a result, the example case shows the business market. A "product failure" occurs when a company is unable to meet the strategic Objectives & Key Results (OKRs) targets set for the product. So, in this case, it can be claimed that there are many possible causes for new products to fail.

Learn more about Business markets here:

https://brainly.com/question/13899043

#SPJ4

FILL IN THE BLANK. Identify the missing word(s) in the following sentence: An organization is a person or a group of people that has its own functions with _____________ to achieve its objectives?

Answers

An organization is a person or a group of people who each perform certain roles and have corresponding responsibilities, powers, and connections in order to accomplish goals.

What do individuals in a group refer to as an organization?

A cooperative group of individuals forms an organization, which can be a business, neighborhood association, nonprofit, or union. A person, a group, a business, or the process of creating or producing anything can all be considered "organizations."

What kind of entity unites a group of individuals who might do functional staff or line duties?

Line-staff organization is a type of management approach in which higher-ups (such as managers) set goals and offer directives that are then carried out by staff and other workers. In a large, complex corporation, flexibility is sought for but not at the expense of management authority.

Learn more about Line-staff organization: https://brainly.com/question/28195868

#SPJ4

The complete question is:

FILL IN THE BLANK.

Identify the missing word(s) in the following sentence:

An organization is a person or a group of people that has its own functions with _____________ to achieve its objectives?

clay and marian are married and will file a joint return.marian is a u.s. citizen with a valid social security number. clay is a resident alien with an individual taxpayer identification number (itin).marian worked in 2022 and earned wages of $32,000. clay worked part-time and earned wages of $18,000.the washingtons have two children: erin, age 12 and jenny, age 18.the washingtons provided the total support for their two children, who lived with them in the u.s. all year. erin and jenny are u.s. citizens and have valid social security numbers.7. the washingtons qualify for the credit for other dependents. true or false

Answers

It is true that Clay and Marian Washington who provided the total support for their two children, who lived with them in the U.S. all year will qualify for the child tax credit for other dependents.

What is child tax credit?

This tax credit, worth up to $2,000 for each qualifying child, helps to offset the costs of raising children. A person must earn more than $2,500 to be eligible for a Child Tax Credit refund.

For 2022, the Credit for Other Dependents is worth up to $500 and the Child Tax Credit is worth up to $2,000.

According to the IRS, a dependent is defined as a qualifying kid (a child who is under the age of 19, under 24 if they are full-time students, or any age if they are permanently and totally incapacitated), or a qualified relative.

The Washington's would be qualified for the credit for other dependents as Washington's as both come under age 19 which is a condition for qualifying.

Therefore, the statement is true.

To learn more about child tax credit, click here:

https://brainly.com/question/30447117

#SPJ1

During the process of mapping the consumption chain of a product, Nina looks at the methods followed by companies which send their engineers to check laptops when they detect that a possible bug could be affecting a system. Which of the following questions does this example address?
A. What if customers aren't satisfied and need a return or exchange?
B. What help do customers need to become familiar with the product?
C. How is your product stored?
D. How is your product repaired, serviced, or disposed of?

Answers

Option D is correct. How is your product maintained, disposed of, or repaired?

The maintenance product is what?

The term "Maintained Products" refers to hardware, software, or peripheral products for which Services are either included with the Products or necessary as part of a Service Offering chosen and ordered by the Customer, accepted by ISL, and noted on the Invoice, as well as any updates or modifications thereto that may occur from time to time.

What does "product support" mean?

a service offered by businesses that sell technical items, helping clients with issues: You will be responsible for offering product support to clients that contact our technical helpline. Compare.

To Know more about product maintained

https://brainly.com/question/29748356

#SPJ4

A follower with low-level motivation and mid-to-high level ability to complete the job benefits from a. A leader who provides a high level of support b. A leader who directs tasks carefully c. A leader who stays out of the day-to-day tasks d. A leader who is both a cheerleader and authoritarian

Answers

A follower with low-level motivation and mid-to-high level ability to complete the job benefits from leader who is both a cheerleader and authoritarian. Option D is correct.

Leadership: What Is It?

In business, leadership is the ability of a company's management to set and achieve difficult goals, act quickly and decisively when necessary, outperform the competition, and motivate others to perform at their best.

Why is leadership important in management?

Leaders provide direction and vision, inspire others to achieve the organization's goals, and contribute to the creation of a successful environment by encouraging team members to communicate and work together.

Learn more about leadership :

brainly.com/question/25996547

#SPJ1

prepare a job cost sheet for job 9, which includes costs for direct materials, direct labor, overhead, and total cost

Answers

 Direct materials Direct Labor Overhead Total Cost

 Req No. Amount Time ticket no Amount Cost Applied  

07/01 Q 4698 $1,850 W 3393 $1,200 $1,320 $4370

07/05 Q 4725 $1,600 W 3479 $1,050 $1,155 $3805

07/10     W 3559 $ 900 $990 $1890

   $3,450   $3,150 $3,465 $10,065

Direct labour costs are a portion of the wage bill or payroll that are particularly and frequently tied to or associated with the manufacture of a good, a particular task order, or the provision of a service. Furthermore, we may add that it represents the cost of the labour put in by those workers who really build the product on the assembly line.How to determine the direct labour cost before starting the work citing knowledge, skill, etc. when discussing the job's requirements.placing the appropriate individuals in the right positions.Usage Costs manufacturing include direct labour costs.

Learn more about direct labor:

https://brainly.com/question/14348614

#SPJ4

research online and find two software tools for bank account reconciliation. try out both tools and write a 500-word report comparing their features and benefits.

Answers

For this comparison, I chose to research and evaluate two software tools for bank account reconciliation: Bank Reconciliation Services from Sage and Bank Reconciliation from QuickBooks.

For businesses, bank account reconciliation is a critical component of financial management. Reconciling a bank account involves comparing the transactions recorded in the business’s financial records with the transactions recorded by the bank in the account statement. Reconciliation helps ensure accuracy and completeness of the financial records, and serves as an important internal control measure.

For this comparison, I chose to research and evaluate two software tools for bank account reconciliation: Bank Reconciliation Services from Sage and Bank Reconciliation from QuickBooks.

Sage Bank Reconciliation Services is a cloud-based solution that allows users to quickly reconcile their bank accounts. It is designed to help streamline the bank reconciliation process, saving businesses time and money. The software allows users to easily import bank statements, and provides an intuitive user interface for quickly reconciling transactions.

QuickBooks Bank Reconciliation is another cloud-based solution for reconciling bank accounts. It provides users with an easy-to-use interface for quickly reconciling transactions, and also allows users to easily import bank statements. Additionally, QuickBooks Bank Reconciliation provides users with reporting capabilities, allowing them to generate reports to analyze their financial data.

Sage Bank Reconciliation Services provides an audit trail feature, allowing users to easily review and approve reconciliations. Additionally, Sage Bank Reconciliation Services provides users with a range of reporting capabilities, allowing them to easily analyze their financial data. QuickBooks Bank Reconciliation does not provide an audit trail feature, and does not provide users with the same range of reporting capabilities as Sage Bank Reconciliation Services.

To learn more about bank account reconciliation link is here

brainly.com/question/28436421

#SPJ4

if national income accountants fail to make an adequate adjustment for increases in the quality of goods and services over time, ____

Answers

The GDP deflator will overestimate inflation if national income accountants fail to account for changes in the quality of goods and services over time.

What is the GDP deflator used for?

It is used to figure out how much new domestically produced final goods and services cost each year in a country. a measure of inflation in the prices of US-produced goods and services, including exports. Although they are calculated in different ways, the GDP price index and the gross domestic price deflator are closely related. GDP deflator, inflation, and long definition The annual growth rate of the GDP implicit deflator is used to measure inflation, which depicts the rate of price change throughout the economy.

To learn more about national income visit :

https://brainly.com/question/30462883

#SPJ4

which of the following accounts are listed in a post-closing trial balance? (select all that apply.) check all that apply salaries expense salaries expense supplies supplies retained earnings retained earnings dividends dividends service revenue service revenue

Answers

Salaries expense, suppliers and dividends are listed in post-closing trial balance.

What is Salaries expense?

Salaries expense is the cost incurred by a company for the compensation paid to its employees. This includes all forms of payment to employees, including salaries, wages, bonuses, commissions, and benefits. The salaries expense is a significant expense item for most businesses, and it is critical to accurately track and record all employee-related costs to ensure accurate financial statements. In addition, the salaries expense also includes employer contributions to employee benefits such as health insurance, retirement plans, and payroll taxes. It is important for companies to budget for salaries expense, as it is a significant factor in determining profitability and cash flow. Effective management of salaries expense requires a combination of proper staffing levels, competitive compensation, and efficient payroll processes.

To learn more about Salaries expense, visit:

https://brainly.com/question/17252581

#SPJ1

compared to checks, paper currency and coins have the major drawbacks that they must be backed by gold. are hard to counterfeit. are not the most liquid assets. are easily stolen.

Answers

One of the major drawbacks of paper currency is that they are easily stolen.

What is currency?

A currency is the standardization of money, including banknotes and coins, that is used or in circulation as a means of exchange. A currency can also be defined more broadly as a system of money that has been used often over time within a particular setting, particularly by residents of a country state.

The term "currency" refers to the legal tender or formal mode of payment of a nation or area. The US dollar, euro, Japanese yen, British pound, and Swiss franc are some of the most well-known currencies.

Learn more about currency here:

https://brainly.com/question/22366324

#SPJ1

A broker needs to train affiliated licensees on properly following disclosure requirements. Which of these strategies will help the training initiative be most effective?
a. Offer multiple classes so that new licensees are trained separately from experienced salespeople.
b. Have all associates take a multiple choice exam at the end of the training.
c. Use a "scared straight" approach by asking licensees who have been disciplined for disclosure errors to speak at the training.
d. Create a document listing the disclosure rules and require all associates to sign an acknowledgment of receipt.

Answers

A broker needs to train affiliated licensees on properly following disclosure requirements. The strategies that will help the training initiative be most effective Is option A: Offer multiple classes so that new licensees are trained separately from experienced salespeople.

The most effective approach to training affiliated licensees on disclosure requirements is to offer tailored training for different experience levels.

This allows for targeted training to address knowledge gaps and ensures effective learning and retention of information.

Choice exams, a "scared straight" approach, or providing a document with rules alone are not as effective.

Option A allows for efficient training by separating new and experienced licensees and providing foundational or advanced courses accordingly.

Overall, offering multiple classes for different experience levels is the best strategy for training affiliated licensees on disclosure requirements.

Therefore the correct answer is option A.

Learn more about affiliates.

https://brainly.com/question/18764046

#SPJ11

fill in the blank. suppose the equilibrium price for basketballs is $23. if every store prices their basketballs at $21, this would lead to a___and would put pressure on prices.

Answers

When market price is below the equilibrium price than it results in shortage and puts upward pressure on the prices.

The correct answer is shortage; upward pressure.

When market prices of the goods are below the equilibrium price then consumers increase the demand for the good due to lower prices. When demand increases it leads to shortage of goods in the market as producers will supply less goods below the market price and consumers would demand more. When demand is more than supply it puts upward pressure on the prices of goods resulting in increase in the price.

For more information on shortage, refer to:

https://brainly.com/question/28607026

#SPJ4

This would lead to a shortage and would put pressure on prices to increase.

Equilibrium price is the market price at which the quantity of goods or services demanded by buyers is equal to the quantity of goods or services supplied by sellers. At the equilibrium price, there is no excess supply or demand in the market.

Shortage refers to a situation in a market where the quantity demanded of a good or service is greater than the quantity supplied, at the current market price. In other words, when the market price is below the equilibrium price, there is excess demand for the good or service, leading to a shortage. This can result in long wait times, increased competition, and upward pressure on prices.

For such more questions shortage: brainly.com/question/28607026

#SPJ4

mitra associates purchased equipment for $5,000, by paying $1,000 cash and agreeing to pay the balance in 30 days. this transaction would be recorded with which of the following entries?

Answers

Option (a), Debit Equipment for $5,000, Credit Cash for $1,000, and Credit Accounts Payable for $4,000.

In terms of accounts payable, what do the terms debit and credit mean?

The accounts payable account is credited when a company makes a credit purchase of goods or services. There is a debit to the balance as a result of the repayment of a portion of the company's account payable.

Is equipment, a debit or a credit?

The equipment account in the company's accounting software shows a debit balance. The equipment is considered one of the organization's fixed assets when it is used for legitimate commercial operations.

Equipment- debit                                                 $5,000

Accounts Payable- credit                                                        $4,000

Cash- credit                                                                              $1,000

Learn more about Accounts Payable: https://brainly.com/question/30332239

#SPJ4

The complete question is:

Mitra associates purchased equipment for $5,000, by paying $1,000 cash and agreeing to pay the balance in 30 days. this transaction would be recorded with which of the following entries?

credit to Accounts Payable for $4,000, credit to Cash for $1,000 and debit to Equipment for $5,000debit to Accounts Payable for $4,000, credit to Cash for $1,000 and debit to Equipment for $5,000credit to Accounts Payable for $4,000, debit to Cash for $1,000 and debit to Equipment for $5,000

Which of the following would most likely cause a leftward shift in demand for a specific brand of cosmetics products? Select the correct answer below: on social media the brand releases a series of advertisements that become very popular a celebrity endorses the brand the brand increases the prices of its products substantially journalists publish a sensational report in a major publication about the brand's secret history of testing its products on animals

Answers

This would cause the demand curve to shift to the left due to adverse publicity would most likely cause a leftward shift in demand for a specific brand of cosmetics products.

What does the economic demand curve mean?

The demand curve is a graphical depiction of the connection between the cost of a commodity or service and the amount demanded over a specific time period.

                              The price will often be shown on the left vertical axis in a representation, and the amount needed will typically be shown on the horizontal axis.

What causes a demand curve?

The demand schedule serves as the foundation for the demand curve. The demand schedule outlines the precise quantity of a product or service that will be purchased at various pricing points. The amount demanded rises as the price falls, which is a crucial point to remember.

Learn more about the demand curve

brainly.com/question/17256775

#SPJ1

kaskin, inc., stock has a beta of 1.2 and quinn, inc., stock has a beta of .6. which of the following statements is most accurate? question 9 options: a. the stock of kaskin, inc., has more total risk than quinn, inc. the expected rate of return will be higher for the stock of kaskin,inc., b. than that of quinn, inc. the stock of quinn, inc., has more systematic risk than that of kaskin, inc. c. the stock of quinn, inc., has more diversifiable risk than that of kaskin, inc.

Answers

In the following question, among the given options, kaskin, inc., stock has a beta of 1.2 and quinn, inc., stock has a beta of .6. Option B "than that of quinn, inc. the stock of quinn, inc., has more systematic risk than that of kaskin, inc" is the most accurate statement.

Beta measures the systematic risk of a stock, which is the risk that cannot be diversified away by investing in a portfolio of multiple stocks. A beta of 1 indicates that the stock has the same systematic risk as the overall market. A beta greater than 1 indicates higher systematic risk, while a beta less than 1 indicates lower systematic risk.

Here, kaskin, inc. has a beta of 1.2, which means that its stock has higher systematic risk than the overall market, while quinn, inc. has a beta of 0.6, indicating lower systematic risk than the overall market. Therefore, the stock of quinn, inc. has more systematic risk than that of kaskin, inc.

Total risk includes both systematic risk and diversifiable risk. Diversifiable risk is the risk that can be reduced by diversifying across multiple assets. It is specific to the individual company and can be eliminated by diversification. Since beta measures only systematic risk, it cannot be used to compare the total risk of two stocks.

Therefore, option B is the most accurate statement.

For more such questions on Beta measures

https://brainly.com/question/14271679

#SPJ4

multiple versus single overhead rates, activity drivers deoro company has identified the following overhead activities, costs, and activity drivers for the coming year: activity expected cost activity driver activity capacity setting up equipment $480,000 number of setups 600 ordering costs 360,000 number of orders 18,000 machine costs 840,000 machine hours 42,000 receiving 400,000 receiving hours 10,000 deoro produces two models of dishwashers with the following expected prime costs and activity demands: model a model b direct materials $600,000 $800,000 direct labor 480,000 480,000 units completed 16,000 8,000 direct labor hours 6,000 2,000 number of setups 400 200 number of orders 6,000 12,000 machine hours 24,000 18,000 receiving hours 3,000 7,000 the company's normal activity is 8,000 direct labor hours.

Answers

The unit cost for each model using direct labor hours to apply overheads are $165  and $225

Determining the total amount for the given questions -

1) Determining the unit cost

Overhead rate = Direct labor + Ordering cost + Machine cost +Receiving/ Direct labor hour for A + Direct labor hour for B

= 480,000 + 360,000 + 840,000 +400,000 / 6,000+2,000

= 2,08,0000/ 8000

= 260

Model A cost per unit

= Direct material +Setting up /Units +(Direct labor hour × Overhead rate/Units

=(600,000+480,000)/16,000 +( 6,000 × 260/16,000)

= 165

Model B cost per unit

= 800,000 + 480,000 / 8,000 + (2,000 × 260/8,000 )

= 225

2) Determining the unit cost for each model using the four activity drivers

Model A cost  

=((Direct material + direct labor)+(direct labor×no. of setups / number of setup) + (ordering cost x orders / machine hours) + (machine costs x orders/ machine hours) + (receiving×receiving hours/ receiving hours)) / Units

= (( 600,000+ 480,000) + ( 480,000 × 400/600) + ( 360,000× 12,000/ 18,000) +( 840,000 × 18,000/42,000) + ( 400,000 × 3,000/10,000)) / 16,000

= 32.50

Model B cost

= (( 800,000+ 480,000) + ( 480,000×200/600) + ( 360,000 × 12,000/18,000) +( 840,000 × 18,000/42,000) + ( 400,000 × 7,000/ 10,000))/8,000

= 290

3) The more accurate cost assignment is produced by Activity Driver Method.

Complete Question:

Multiple Versus Single Overhead Rates, Activity Drivers Deoro Company has identified the following overhead activities, costs, and activity drivers for the coming year: Activity Expected Cost Activity Driver Activity Capacity Setting up equipment $480,000 Number of setups 600 Ordering costs 360,000 Number of orders 18,000 Machine costs 840,000 Machine hours 42,000 Receiving 400,000 Receiving hours 10,000 Deoro produces two models of dishwashers with the following expected prime costs and activity demands: Model A Model B Direct materials $600,000 $800,000 Direct labor $480,000 $480,000 Units completed 16,000 8,000 Direct labor hours 6,000 2,000 Number of setups 400 200 Number of orders 6,000 12,000 Machine hours 24,000 18,000 Receiving hours 3,000 7,000 The company's normal activity is 8,000 direct labor hours. Required: 1. Determine the unit cost for each model using direct labor hours to apply overhead. Unit Cost Model A $ Model B $ 2. Determine the unit cost for each model using the four activity drivers. Round your answers to nearest cent. Unit Cost Model A $ Model B $ 3. Which method produces the more accurate cost assignment?

Read more about overheads on:

https://brainly.com/question/26454135

#SPJ4

Streamline Luggage Company markets it roll-aboard suitcases to international executives and business people that travel regularly. This is an example of segmenting based on _____.

Answers

Streamline Luggage Company markets it roll-aboard suitcases to international executives and business people that travel regularly. This is an example of segmenting based on demographics

What is segmentation?

Segmentation is the process of dividing a market into smaller groups of consumers with similar needs, wants, or characteristics. In this case, Streamline Luggage Company has segmented its market based on two criteria:

Demographics: The company is targeting international executives and business people, which suggests that it has identified a specific group of consumers based on their occupation or job title. This demographic segmentation helps the company tailor its marketing messages and product features to meet the unique needs and preferences of this group.

Behavior: The company is also targeting consumers who travel regularly. This behavioral segmentation recognizes that travel frequency is an important factor in determining luggage needs, and that consumers who travel frequently may have different requirements and preferences than those who travel less frequently.

Read more on segmentation here:https://brainly.com/question/5545577

#SPJ1

vance enterprises makes computer components. the company uses direct labor hours as its application base. the predetermined overhead rate for the year was $18.56 per direct labor hour. the estimated manufacturing overhead for the year was $47,362. rounded to the nearest hour, the budgeted number of direct labor hours for the year was 5,222 3,502 2,552 3,225

Answers

The budgeted number of direct hours for the year can be found to be C. 2,552.

How to find the number of hours ?

The number of direct hours that was budgeted for the year can be found by the formula :

= Amount budgeted for manufacturing overhead / Amount per direct labor hour

Amount budgeted for manufacturing overhead = $ 47, 362

Amount per direct labor hour = $ 18. 56

The number of hours is:

= 47, 362 / 18. 56

= 2, 551. 83

= 2, 552 hours

Find out more on direct labor hours at https://brainly.com/question/29101273

#SPJ1

The prepaid insurance account has a $4700 debit balance to start the year. A review of insurance policies and payments shows that $900 of unexpired insurance remains at year-end. Record the December 31 adjusting entry.

Answers

Every time a payment is made that prepays a charge, a prepaid account, such as Prepaid Insurance, is debited and the cash account is credited.

On the company's balance sheet, the prepayment is displayed as an asset. An adjustment entry must be finished by debiting the actual expense and crediting the prepaid expense account. The payment for the goods is made during the current accounting period, even when the delivery is received in the one after that. When you use the prepaid item, your Prepaid Expense account will be decreased while your Real Expense account will be increased. Debit your Prepaid Expense account and credit your Expense account to accomplish this. In essence, an adjustment entry must be filed in the month that the item is incurred to debit the expenditure account and credit the prepaid account.

Learn more about Insurance here:

https://brainly.com/question/30561740

#SPJ4

T/F codes of ethical conduct adopted by corporations and professional associations have the same legal status as ordinances.

Answers

This statement is True, codes of ethical conduct adopted by corporations and professional associations have the same legal status as ordinances.

Associations refer to groups of individuals or organizations that share a common interest or purpose and work together to achieve their goals. These groups may be formed for a variety of reasons, such as to advocate for a specific cause, promote a particular industry or profession, or provide support and resources to their members.

Associations typically have a formal structure, with bylaws and a governing board, and may offer various services to their members, such as networking opportunities, training and education, and access to specialized resources. They may also engage in lobbying or other advocacy efforts on behalf of their members. Associations can be found in many different fields, including business, healthcare, education, and the arts.

To learn more about Associations visit here:

brainly.com/question/9511999

#SPJ4

research shows that which one of the following is not a strategy used by firms engaged in successful turnarounds? multiple choice a. asset and cost surgery selective b. product and market c. pruning piecemeal productivity d. improvements global expansion

Answers

Turnaround strategy is a revival measure for overcoming the hassle of industrial sickness. It is a approach to convert a loss-making industrial unit to a profitable one.

Turnaround is a restructuring procedure that converts the loss-making enterprise into a profitable one.

What is a profitable turnaround?

A successful turnaround has seven critical elements: Crisis management – Taking control; performing essential cash management; decreasing assets; arranging momentary funding; starting cost-reduction measures.

Turnaround approach is the action of reversing a terrible fashion and turning round the organization into profitability. Turnaround method derives its name from the motion of reversing a negative fashion and turning round the enterprise into profitability. The turning around business enterprise aims at consistent state and growth.

Learn more about turnaround here:

https://brainly.com/question/30831320#SPJ1

Refer to the association marked with the number 1 in the preceding diagram. Which of the following is the best description of the association?
•Each employee participates in a minimum of zero purchases.
•Each employee participates in at least one purchase.
•Each employee participates in a maximum of one purchase.
•Only employees in the shipping and receiving department receive purchases.
•None of these are a description of the association.

Answers

Option (A) Each employee participates in a minimum of zero purchases gives the best description of the association.

The term "business association" refers to membership groups that support and engage in the commercial pursuits of their members. Additionally, it alludes to membership groups that support and actively engage in promoting their members' commercial interests. Associations frequently carry out a variety of tasks that would be expensive and time-consuming for one company to handle independently. Activities including research, lobbying, establishing industry standards, and information gathering may fall under this category. Association representatives claim that by uniting their voices under one umbrella, businesses can develop a powerful presence that demonstrates their unity and protects their common interests. Participating actively in business alliances is a priority for big businesses.

learn more about business associate here:

https://brainly.com/question/28052045

#SPJ4

based on your answer to the last question, which of the following prices of trade (that is, price of wheat in terms of olive oil) would allow both liechtenstein and slovenia to gain from trade? check all that apply.
A. 1 crate of olive oil per bushel of wheat B. 3 crates of olive oil per bushel of wheat C. 7 crates of olive oil per bushel of wheat D. 15 crates of olive oil per bushel of wheat

Answers

The option A "1 crate of olive oil per bushel of wheat" option B "3 crates of olive oil per bushel of wheat" and option C "7 crates of olive oil per bushel of wheat" would allow both Liechtenstein and Slovenia to gain from trade. So the option A is correct.

This is because Liechtenstein is able to export wheat to Slovenia in exchange for olive oil. With enough olive oil for each bushel of wheat, Liechtenstein can make a profit from the sale of their wheat.

At the same time, Slovenia can benefit from the purchase of wheat from Liechtenstein, as it can use the wheat to produce food or other items that it can then sell.

With three, or even seven crates of olive oil per bushel of wheat, Slovenia can make a profit from the sale of olive oil while still receiving enough wheat to meet its needs.

To learn more about bushel of wheat link is here

brainly.com/question/29974159

#SPJ4

depreciation expense question 36 options: is listed on the income statement as a variable expense. is subtracted from the statement of cash flows. is added to the statement of cash flows because it is not an expenditure. appears only on the income statement.

Answers

Depreciation expense is added to the statement of cash flows because it is not an expenditure. Thus, option 3 is correct.

Depreciation expense on the income statement is what?

The income statement lists depreciation expenditure as an expense tο reflect how much of an asset's wοrth has been depleted for the year. As a result, it is neither an asset nor a liability.

Due tο the fact that it raises a company's operational costs, depreciation is viewed as an expense fοr accounting purposes. Over the course of their useful life, machines and οther assets experience wear and tear and lose value. Depreciation expense is displayed οn the income statement.

To know mοre about depreciation expense, refer to:

brainly.com/question/29748690

#SPJ4

Complete question:

Depreciation expense:

is listed on the income statement as a variable expense.is subtracted from the statement of cash flows.is added to the statement of cash flows because it is not an expenditure.appears only on the income statement.

Which of the following makes comparisons of the financial conditions at multiple organizations possible:
answer choices
Bookkeeping
Source documents
Accounting standards
Trial balance

Answers

The balance sheet, which is a financial statement, details the financial situation of a company at a specific point in time.

The financial standing of an entity, whether it be a corporation, private limited company, sole proprietorship, commercial partnership, governmental agency, or another sort of entity, is described in its balance sheet. A balance sheet, usually referred to as a statement of financial status, is an overview of the company's financial situation at a certain period. A balance sheet provides a snapshot of a company's financial status at a specific point in time, as opposed to an income statement, commonly known as a profit and loss. A balance sheet shows the financial standing of your organization at any given time.

Learn more about A balance sheet here:

https://brainly.com/question/29751131

#SPJ4

Firm Market Share (%)A 32B 25C 21D 15E 4F 3Refer to the data. Suppose that firms in this industry split up such that there were 25 firms, each with a 4 percent market share. The four-firm concentration ratio and the Herfindahl index respectively would beMultiple Choicea. 16 percent and 400.b. 100 percent and 10,000.c. 16 percent and 16.d. 400 percent and 64.

Answers

The correct option is D. The four-firm concentration ratio and the Herfindahl index respectively would be 16 percent and 400.

Firm concentration ratio = share of 4 largest firms/ total share of the     firm

                                        = 4+4+4+4/100= 16/100 = 16 percent

Herfindahl index= (4)^2 + (4)^2 +(4)^2 +.......+(4)^2

                           = 16+16 +......+16 = 16×25= 400.

A market is any region in which or greater occasions can meet to interact in a monetary transaction—even the ones that do not involve legal gentleness. A market transaction might also moreover comprise goods, services, statistics, foreign money, or any aggregate of those that bypass from one birthday celebration to another.

In elegant, the function of a marketplace is to collect products from scattered resources and channel them to scattered stores. From the factor of view of the seller, dealers channel the call for their product; from the thing of view of the consumer, they bring elements within his obtain. A marketplace is an area wherein buyers and sellers can meet to facilitate the change or transaction of products and services. other examples encompass illegal markets, public sale markets, and economic markets.

To learn more about Market visit here:

brainly.com/question/13414268

#SPJ4

Complete Question:

Firm Market Share (%)A 32B 25C 21D 15E 4F 3Refer to the data. Suppose that firms in this industry split up such that there were 25 firms, each with a 4 percent market share. The four-firm concentration ratio and the Herfindahl index respectively would be

1. 100 percent and 10,000.

2. 16 percent and 16.

3. 400 percent and 64.

4. 16 percent and 400.

Other Questions
The heart is an organ in the circulatory system. Muscle tissue in the heart contracts to pump blood to the body. Connective and epithelial tissues in the heart hold the muscle cells together and in place in the chest. Nervous tissue in the heart coordinates how fast and hard the muscle cells contract. renewal or modification of the cell membrane is a function of the For 3y-2x=-18 determine the value of y when x = 0, and the value of x when y = 0 what kind of slope is x = -5 What are the Bloods and Crips fighting over? artists may weld, glue, bolt, screw, nail, and wire individual pieces together to create which type of sculpture? help please see photo why is cell division important for multicellular organisms In the diagram, segment AD bisects angle BAC.Given the following segment lengths, find the value of x.Round to the nearest tenth.AB = 23AC = 18 FILL IN THE BLANK. our goal as a nation and as a society must be to free ourselves completely of the __ of racial prejudices Though dark and light phenotypes existed among the moth populations, an albino moth was recently discovered. Complete the data below in order to better understand how this may DNA = ATCG happen. Complementary rules MRNA-UAGS Dark moth - Dominant allele: DNA: TACCGTCGCATACACTGGGGTCAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC mRNA: AAS: Light moth Recessive allele: DNA: mRNA: AAS: Albino moth DNA: mRNA: AAS: - TACCGTCGCATACACTGGGGTTAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC Unknown allele: TACCGTCGCATACACTGGGGTCAGGACGAGATCGCATCCAGACGGGTCGTCGGACATGATC When responding below, be sure to use the precise terms for the mutations when appropriate. Write a claim to answer this question: What you think occurred to produce the dark and light phenotypes? Provide specific evidence from the mRNA-amino acid sequences for this claim: Propose a hypothesis as to what occurred to produce an albino moth: find the measure of CDE,BC,AB, and CAB. What do you think about Morries decision when it comes to his epitaph? (Claim, Evidence, Reasoning) What was the effect of the Second Morrill Land Grant Act of 1890?Colleges and universities for Black students were created.Rural areas received their first universities.The first university for women was founded.It founded "normal schools" for the training of teachers. Can you replace the glass plate in a microwave? in tableau, measures are automatically aggregated to the granularity of the view, and the granularity, or number of marks, is set by ____ Provide a counterexample to the following statement: The number n is an even integer if an only if 3n + 2 is an even integer. Maximize Z = 7X1 + 5X2Subject to X1 + 2X2 6 4X1 + 3X2 12 X1, X2 0 I am having trouble in finding the path for hopscotch. I do not quite understand what I have to do? A generic element, a, is composed of two isotopes, 208a and 204a. 208a has a natural abundance of 55% and an isotopic mass of 207. 98 amu, and 204a has a nautral abundance of 45% and an isotopic mass of 203. 97 amu. What is the average atomic mass of this element?.