concequences of corruption in public sector​

Answers

Answer 1

Answer:potential negative effects of corruption Public sector corruption has both direct and indirect effects on the institutions of a country. The direct costs of corruption include not only bribes, but also funds wasted oninflated procurement contract prices, and stolen public assets.

Explanation:

and yea


Related Questions

common comminicate disieses with there symtoms and preventine measure?​

Answers

Answer:

Hiv

tuberculosis

Explanation:

fever,chill,rash,mouth sores,sore throat.

cough,lost of appetite, weight loss,chill

"when does one’s body start storing fat either by increasing the number of fat cells or by increasing the size of existing fat cells?" At birth, after the first year of life, adulthood, or end of adolescence

Answers

Answer:

When there are excess amino acids, glucose, fatty acids and glycerol in the blood, insulin produced by the pancreas causes the cell to absorb and store them. Fat cell, liver, and muscle cells are especially specialized for this role. Fat cells also convert excess proteins and carbohydrates to fats (a process which is less efficient that absorbing and storing fats from the bloodstream). The more fat droplets they store the larger the cells become

Explanation:

I hope this helps you out

in which country did the gothic style first emerge​

Answers

Answer:

France

Explanation:

Gothic architecture began in the earlier 12th century in northwest France and England and spread throughout Latin Europe in the 13th century; by 1300, a first "international style" of Gothic had developed, with common design features and formal language.

The correct answer Is France<3333

Anita is concerned that she’ll be diagnosed with type 2 diabetes. What type of lifestyle changes could she make to help prevent this diagnosis

Answers

She should stop eating so much sugars because type 2 diabetes are caused by an excessive amount of sugar eating. So she should start balancing out her meals more and stop eating so many sugars. Hope this helps!

According to MyPlate guidlines, grains should make up ____ of your plate, fruits should make up ____ of your plate, protein should make up ____ of your plate, and vegetables should make up ____ of your plate.

Answers

Answer:

about one-fourth; less than one-fourth; about one fourth; more than one- fourth.

Explanation:

A healthy meal planning can be defined as a process which involves taking out time to design and develop nutritious meals that gives the body the required amount of daily nutrients and energy for optimal performance. Also, it ensures the consumer stays within his or her daily calorie intake threshold so as to avoid adding extra weight or fats.

Nutrients can be defined as the micro and macro components of food that are essential for well-being, survival and good health because they provide the required amount of energy. Thus, nutrients are used for repairing worn-out body tissues, cells and regulation of chemical processes within the body of a living organism.

Basically, there are six (6) major nutrients required for the proper functioning of the body of a living organism, these are; carbohydrate, protein, vitamins, fat (lipids), water and minerals.

MyPlate is an online resource that is saddled with the responsibility of providing recipes, dietary guidelines, cookbooks and healthy eating habits for the people, over a specific period of time.

According to MyPlate guidelines, grains should make up about one-fourth (¼) of your plate, fruits should make up less than one-fourth (¼) of your plate, protein should make up about one fourth (¼) of your plate, and vegetables should make up more than one- fourth (¼) of your plate.

Answer:

According to MyPlate guidelines, grains should make up

✔ about one-forth

of your plate, fruits should make up

✔ less than one-fourth

of your plate, protein should make up

✔ about one-fourth

of your plate, and vegetables should make up

✔ more than one-fourth

of your plate.

Is it true

There is never an excuse for violence except in self defence? Never over words?

Answers

Answer:

true

there's always a way to convince someone using words

violence is often the last resort for something

I sent you two screenshots, I hope they are of valuable use to you.

having a shower after sexual intercourse protects you from contracting hiv and other STIs. true or false​

Answers

Answer:

false

Explanation:

the only sure way of protecting yourself from any sexual contracted disease is to remain abstinent. however, if you decide to not choose to be abstinent the second best method to avoid anything would be the act of using condoms which even though is not 100 percent effective it is still more effective than any other option. a shower is absolutely in no way going to protect you from obtaining any std after intercourse.

when utensils are washed and sanitized by hand, a _____ compartment sink must be provided A) Single B) Two C) Three

Answers

Answer:

b

Explanation:

Help me please.!!! With 2-4

Answers

2 no true ,3 no All of above and 4 false

What is the current situation in Vietnam

Answers

Answer:

The current situation is that it has one of the lowest unemployment rates.

Which of these is provided by a government website and intended to reduce
injuries?

Answers

Answer:

The correct answer is - safe practices instructions.

Explanation:

Safe- practices instructions are the instruction provided by government web portals in order to provide information and intended to reduce injuries. Such government portals help in enhance awareness among people for avoiding such injury by providing precautions and instructions.

These portals of the government educate people are very beneficial as they give information how what to do in case of injuries. These websites also provide data about the injuries.

Answer: C: Safe Practices Instructions.

Explanation: I hope this helps! ;)

HELP Please

What does a triangle have to do with your health?

Answers

Answer:

I hope this helps

Explanation:

The Health Triangle. Health is the measure of our body's efficiency and overall well-being. The health triangle is a measure of the different aspects of health. The health triangle consists of Physical, Social, and Mental Health.

Health Care: Mastery Test
Submit Tes
Drag each tile to the correct location.
Match the treatment to the culture that commonly follows it.
an ancient system of medicine that
originated in India
believes that illness is a result of an
imbalance in energy
use of acupuncture as a treatment
method
uses plants and minerals as
medicine as well as techniques
such as meditation and exercise
Ayurveda
Traditional Chinese Medicine
2021 Edmentum. All rights reserved.

Answers

Answer:

Ayurveda- an ancient system of medicine that originated in India; believes that illness is a result of an imbalance in energy.

Traditional Chinese Medicine- use of acupuncture as a treatment  method; uses plants and minerals as medicine as well as techniques  such as meditation and exercise

Explanation:

Ayurveda is a treatment method that originates from ancient India and it thrives on the belief system that health is achieved when there is a balance between the three Dosas; namely, Vāta, Pitta, and Kapha. When there is an imbalance between these three, sickness arises. Meditation, traditional medicines, Yoga, oils, etc., are used in treatment.

Traditional Chinese Medicine is rooted in Chinese culture that dates back to some 2000 years ago. Acupuncture, meditation, and exercise, as well as herbal medicines, are employed in treatment.

Both of these methods of treatment are regarded as pseudoscience or quackery because they do not have any scientific-based mechanism of action.

it is often said the media can make or break a person especially sports, personalities .explain how that happens ​

Answers

Answer: Explanation:they can make because, media brings the personality who so ever to the public appearance... And they can break as because they not only show positive side but the negative side as well and most probably the greater negative insight.03-May-2019

THE ARTICLE IS THE SPACE RACE IS OVER BY PAUL KINGSNORTH
PART A: Which of the following best express the central idea of the article?
A
Space colonization is just as unrealistic and overly optimistic now as it was in the 1950s, but fewer people are as interested.
B
Expansion justifies space colonization because it is a key solution to the earth’s overpopulation and damaged environment.
C
People should avoid romanticizing the future and space colonization because it distracts from focusing on current problems on Earth.
D
Space exploration and settlement is making a cultural comeback due to a new golden age of technological advancements.

Answers

The correct answer is b Eggs and she enjoys the five space colonization because it is a key solution on the earth all the population and Tamara

How Do You Know Someone Who Needs Help...Whether someone is addicted to alcohol, tobacco, or drugs... There are physical, behavioral, and social signs a person can look for. Give 2 Characteristics for each sign

This is for my PE class!! pls be right

Answers

Answer:

When they no longer have a sense of what is going on in their lives and dont have control over when they stop

Explanation:

2. Which of the following is the substance in tobacco and electronic devices that
is addictive? *
tar
nicotine
methanol
carbon monoxide

Answers

Answer:

nicotine

Explanation:

Complete a journal entry by responding to the following questions/topics.

What does this statement mean to you and why is it important?

“I began to view clients differently, not as cases with things to fix, but as people with concerns and I had the ability to change their experience.” (Diary of a Medical Assistant, 2014).

Answers

Answer:

yes

Explanation:

because that is it the way it's should br

The medical assistant had a positive perception of patients (clients) which would help them not to think less of themselves while receiving treatment.

Who is a medical assistant?

A medical assistant refers to an individual who is employed as a healthcare professional to work directly with other medical professionals such as doctors, physicians, etc., at medical offices, hospitals, and clinics.

Based on the statement, I can deduce that this medical assistant didn't see his or her patient as mere clients with problems that only require solutions without empathy. Thus, the medical assistant had a positive perception of patients (clients) which would really help in influencing how she relates, acts and proffer solutions to their health-related issues or challenges.

Read more on medical assistant here: https://brainly.com/question/24331637

Select the correct answer.
Which of the following is NOT a trait of a healthy relationship?
O A.
trust and respect
OB.
support and compromise
OC. good communication
OD
dependence
Reset
Next

Answers

Answer:

D

Explanation:

Dependency makes it unequal

What blood tube(s) would you fill to collect a specimen for the CBC and lyteselectrolytes? Which tube would you fill first

Answers

Answer:

testing tubes

Explanation:

the answer is testing tubes

Answer: EDTA tubes or microtainers with purple or Lavender top for CBC

Grenn PST(Plain or serum separator tube)  / Plain Red top for electrolytes test.

Explanation:

The  blood tube to use to collect a specimen for the CBC which means (complete blood count) is the EDTA tubes or microtainers with purple or Lavender  top), of which the sample should be   50-60% full and gently mixed. The sample  can be refrigerated to make the  blood stable for up to 24 hours.

The  blood tube to use to collect a specimen for the electrolytes test is the Grenn PST(Plain or serum separator tube)  / Plain Red top.

2. The order of tube filling first differs with method,

For collection of blood through skin puncture,

The EDTA Tube should be collected first before Plain or serum separator tube  to reduce the risk of blood clotting which would affect the hematological test result.

For collection through the vein  

Plain or serum separator tube should be collected before the EDTA.

See related answer here:https://brainly.com/question/10753712

My mom does a lot for me, she is like every mom who picks up stuff from school for me and works so I can have a good life. But, every single day she tells me that I am ugly and fat, once in the mall she was walking with me and my sister, she stopped and turned around and told me "You will not walk with me because I don't want people thinking I have a fat girl as a daughter" and those words keep repeating over and over in my head all the time. When I was younger I thought the girls who face this problem were being dramatic until I experienced it myself. It hurts, there are many days where she makes pig faces and says "you are useless." Today, she told me a hundred times how ugly and fat I am and how she wished she never had me. She never once apologized. My mom does buy me stuff so I am confused if this is normal because I have always been treated like this. I have never talked to anyone about this. All she ever talked about was how I looked and even when I got straight A's all she would ever say is "ok" and she goes back to my weight. I cry myself to sleep because I think it is just me and that I am overly sensitive and what she is saying is not even that deep. I am so confused, I want to explode and tell the world and tell my aunts who don't even know this is happening because my mom always says what I do wrong but never says what she says to me. What should I do? Please help me.​

Answers

Explanation: If she thinks you are Fat and Ugly that messed up because she's the one who gave birth to you.. this means she is fat and ugly to.. Don't let the negativity get to you. Next time she says anything bad to you just imagine she is saying it to herself..

Suppose you are an HIM professional employed at a health information exchange with 25 component organizations and you see the following report. Evaluate the results relative to data integrity. MRN SSN Last Name First Name Middle DOB Payment 47233 546-23-XXXX Baker Sr. Louis Howard 5/18/1954 Medicaid 158237 135-24-XXXX Watson Michelle Lee 7/22/1942 Medicare 520613 588-32-XXXX Jones Lynn Tara 10/12/1963 Commercial 723341 213-22-XXXX Harris Ann Marie 9/10/1952 Self 894231 588-32-XXXX Jones Tara Lynn 10/21/1963 Commercial 189011 533-44-XXXX Marshall Tucker B. 11/4/1961 Commercial 218220 151-24-XXXX Leonard Timothy Allen 6/17/1943 Medicare 797536 213-22-XXXX Harris-Smythe Ann Marie 9/10/1952 Commercial 36524 315-24-XXXX Watson Michelle Lee 7/22/1924 Medicare 466100 546-23-XXXX Baker Louis Howard 5/18/1945 Medicare 744183 626-26-XXXX Baker Paul Carlson 1/16/1971 Self 237352 641-58-XXXX Carlson Thomas Paul 1/16/1971 Self 898233 213-22-XXXX HarrisSmythe Ann Marie 9/1/1952 Commercial 789321 151-24-XXXX Allen Timothy Leonard 6/17/1934 Medicare 664455 213-22-XXXX SmytheHarris Ann Marie 9/1/1925 Commercial 98723 315-42-XXXX Watson Michelle Lee 7/22/1924 Medicare 587532 546-23-XXXX Baker Howard Louis 5/18/1954 Medicaid Prepare a memo addressed to me from you. Use appropriate memo format and style. In your memo, propose at least five steps to remediate the issue.

Answers

Solution :

Five steps to remediate the issue are :

1. Permit the data entry of the patient details once in the data bas.

2. Using the reference number for the individual patient such that when one of the types in the number, his/her details immediately gets updated into the system.

3. Ensuring the data entry is done by a single person or maximum two persons.

4. Preparing the data directories online.

5. Reverifying the correctness of the data with the concerned patient.

What is one benefit of participating in a team sport?
Select one:
a. Independence
b. Self-reliance
C. Skill-building
d. Socialization

Answers

Answer:

d. Socialization

Explanation:

this is the correct answer

Answer:

B. Self-reliance

..................

If a peace of patient Equipment is defective, who is responsible for firing it

Answers

Answer:

If a tool is defective, remove it from service, and tag it clearly "Out of service for repair". Replace damaged equipment immediately – do not use defective tools "temporarily". Have tools repaired by a qualified person – do not attempt field repairs.

Pretend that you are a physical fitness/gym teacher for a group of 12-year old children. In 2-3 paragraphs, what three benefits of cardiovascular health would you teach them? How would you encourage them to get cardiovascular exercise as adults? Answer may be based on lesson content or you may conduct Internet research. Be sure to copy the URLs of any outside sources you used. 

Answers

Answer:

d

Explanation:

Cardio-vascular health throught out your life is important as it leads to a healthier lifestyle. One benefit is that exercise will help keep you heart healthy. It will help keep the flow going and your heart rate in a normal rythm. Your arteries and veins will keep flowing and be less likely to get clogged.

Second, it will also help prevent other medical issues such as obesity which puts an extra strain on your heart. It will help your fat stay down which will keep the weight off of your other organs. Too much fat and pressure can cause your organs to start shutting down from the weight of the fat.

Someone who has swallowed poison should be given water.

Answers

Answer:

they should have induced vomiting

Explanation:

Answer:

Water should only be given to a human that cannot swallow anything. When someone swallows poisin they should be given milk or ice cream because it dilutes and helps to negate the poisin. Or, you can make them vomit it out.

Explanation:

What are the two types of fitness?

A. heart and lungs related components

B. cardiorespiratory and body composition

C. health and skill related components

D. FITT principle and strength

PLZ HELP ME IM STUCK ON THIS QUESTION

Answers

D is the best answer :) good luck
D. FITT principle and strength

where to document Urine Analysis results, apart from Progress Notes?​

Answers

Answer:

The results of a urine analysis can be noted in tables in addition to progress notes.

Explanation:

In order to expedite the documentation of the results of a urine sample and present more direct and objective information, it is possible to document these results in tables, in place of progress notes. This is because, although progress notes are very important for assessment and documentation, tables are more objective, quick and simple documents that allow the main point of the urine analysis to be presented quickly, as they are not pre-empted to explain the results, but exposes them directly.

How can one use exercise to its upmost potential for boosting the immune system ?

Answers

Answer:

Physical exercise promotes the release of cytokines, increases the circulation of white blood cells and the recruitment of immune cells to injured/infected sites  

Explanation:

Physical exercise is fundamental maintain a healthy immune system. It has been shown that exercise 1-promotes the releases of pro- and anti-inflammatory cytokines which are capable of modulating the growth and activity of immune system cells and blood cells, 2-increases the ongoing exchange of white blood cells (i.e., leukocytes) between the circulation and tissues, and 3-stimulates the recruitment of highly specialized immune (e.g., natural killer cells and T cells) to injured/infected sites in order to identify microorganisms (e.g., bacteria, viruses and fungi) or substances that are potentially harmful and wipe them out. Moreover, it is also important to highlight that excessive physical exercise can deplete the immune system and therefore increase the risk of infection.

____means protecting natural resources, such as water and trees

Answers

Answer:

Conservation

Conservation means protecting natural resources, such as water and trees.

Other Questions
Which of the following describes the parabola with the equation y = x2 3x + 6? A) The axis of symmetry is x = 1.5 and the vertex is (1.5, 12.75). B) The axis of symmetry is x = 1 and the vertex is (1, 3). C) The axis of symmetry is x = 1.5 and the vertex is (1.5, 8.25). D) The axis of symmetry is x = 0 and the vertex is (0, 6). Find the next term of the sequence.21, 15, 9, 3, . . 6603 How many countries in this World? Can you help me with this please (finals) The termite gut environment is lacking a fresh supply of oxygen O2. However, it is rich with food due to the presence of bacteria that contain enzymes capable of breaking down cellulose and lignin, the macromolecules that make wood. Use this information to determine which of following protista groups is more likely to be found in a termite gut.a. Diatoms b. Radiolaria c. Parabasilids d. Rhodophyta e. Foraminifera (Forams) Ifthe fish commission states that the mean length of all fish in spring run is mean =15cm,withthe standard deviation of variance=4cm,what will be the probability that a fish is caught in spring run :between 15cm&19cm? The main objective of most informational texts is to entertain the reader.Please select the best answer from the choices providedF Barry Boots Inc. is considering adding a new line of boots. Based on preliminary market research, management has decided that each pair of boots should be priced at $300. Furthermore, management believes that the profit margin should be 30 percent of sales revenue.What is the target cost?a. $150.75b. $225.50c. $260.00d. $157.50 Cho hai in tch q1=q2=8.10^-7 C t cch nhau 5cm. Xc nh cng in trng ti im:a. Cch q1=2cm, q2=3cmb. Cch q1=5cm, q2=10cmc. Cch q1=5cm, q2=5cmd. Cch q1=4cm, q2=3cm Why does Australia have such unique biodiversity (variety of animals and plants) in its fauna and flora? Apothem=A) 4 units B) 4 (square root) 2 units C) 4 (square root) 3 units Solve for x. 8x = 35 A brick staircase has a total of 17 steps The bottom step requires 131 bricks. Each successive step requires 5 less bricks than the prior one. How many bricks are required to build the staircase? Evaluate x2+9/x2 for each of the given values.What is the value of the expression when x = 3?2310undefinedWhat is the value of the expression when x = 1?2310 undefinedWhat is the value of the expression when x = 0?2310undefined A supervisor is suspicious of a new female employee in an automotivecompany. This is an example of...DiscriminationDiversityPrejudiceTolerance Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3) Activity: write 3 three sentence about the picture. use the correct forms of adjectives in your sentence