answer for brainliest

Answer For Brainliest

Answers

Answer 1

1. Six swimmers from the 10 swimmers were not from UK.

2. The difference between the fastest time and the slowest times is 14.10. The fastest time was 12.40 and the slowest, 26.50.

3. Seven (7) of the 10 swimmers made their swim in the period of 1923-1927.

4. It was 25 years later that America's Florence Chadwick made her swim after G. Ederle.

5. It can be generally said that August, September, and October are the best months for swimming the channel.

6. It can be generally said that swimming the Channel from England to France is a lot difficult than swimming the Channel from France to England.

When is the best time to swim the English Channel?

The best time to swim the English Channel is typically from late July to early September, when the water temperatures are warmest and the weather is most stable. The average water temperature during this time of year is around 15-20°C (59-68°F), which is relatively mild for a long-distance open water swim.

However, swimming the English Channel is still a significant challenge and can be affected by various conditions, such as wind, waves, currents, and shipping traffic. It's also a good idea to consult with experienced channel swimmers, organizations, and local authorities to get the most up-to-date information on the best time to swim the Channel and the current conditions.

Learn more about the English Channel here;

https://brainly.com/question/14604479

#SPJ1


Related Questions

what reason does Edward Abbey give to prove that he is the best person to comment on the harm the building of the Glen Canyon Dam has done to the land

Answers

The inference is that the reason that Edward
Abbey gave to prove that he is the best person to comment on the harm the building of the Glen Canyon Dam is B. He toured the area before and after the dam was built.

please help answer these 3 questions in full scentances!!

Answers

The author's use of the detail that southern businessmen didn't complain about the extra cost of building segregated facilities amplifies the claim of segregation, no matter the cost because it shows how deeply ingrained segregation was in southern society. Even when it was economically disadvantageous, white southern businessmen were willing to pay the extra cost to maintain the racial hierarchy they had created.

What is the The Warmth of Other Suns?

The author's choices about structure affect the message she wants to impart by emphasizing certain themes or ideas. For example, if the author organized the reading chronologically, the message would be different than if she organized it thematically. Organizing the reading thematically allows the author to explore the various ways that segregation affected African Americans across different regions and time periods.

Therefore, in question 3, Wilkerson's use of quoted words affects the reader's perception of her main idea by showing the ways in which African Americans struggled to find their place in a society that was still deeply divided along racial lines. By including direct quotes from individuals, Wilkerson is able to show the diversity of experiences within the African American community and the ways in which they were navigating a society that was still hostile to their presence.

Learn more about  Suns from

https://brainly.com/question/29424459

#SPJ1

F. Scott Fitzgerald's quotation provides an important perspective on literature and its purpose. He believed that literature provides universal themes and ideas. Texts from The Wizard of Oz to Lord of the Flies show that literature reveals themes that almost all readers can relate to in their own lives. In conclusion, literature gives readers a sense of belonging in the world. It can help people feel connected to the characters in stories, to the authors who wrote them, and to one another.

What should be included to make this conclusion more effective?

a concluding sentence
a restatement of the quotation
a summary of the main points
a rephrasing of the thesis

Answers

We can see here that in order to make this conclusion more effective, the following should be included:

What is conclusion?

A conclusion is a statement or a judgement reached after considering the facts or evidence. In other words, it is the final step in reasoning process where you draw a definite and concise inference from the information presented.

Conclusions can be drawn from various forms of evidence, including data, observations, research, and personal experience. In written work, a conclusion is typically found at the end of an article, essay, or research paper and serves to summarize the main points and to provide a final perspective on the topic being discussed.

We see here that the answer above is correct.

Learn more about conclusion on https://brainly.com/question/26093731

#SPJ1

Answer:A restatement of the quotation

Explanation:

edge 2023

how does paragraph 12 help develop the authors claim

Answers

It offers particular information regarding academic achievement derived from the study of the brain. It backs up the premise of brain using logical reasoning.

How does paragraph 3 back up the authors' assertion that music can assist our brains develop from the introduction?

How does paragraph 3 back up the author's assertion in the introduction that music can aid in brain development? It offers precise information from the brain study that is connected to musical education. It defines technical words used in brain research.

How is the notion that learning music can help the brain develop explained in paragraph seven?

How is the notion that learning music can help the brain develop explained in paragraph seven? It emphasizes how many and how difficult the skills that one must master to playing an instrument encourages brain development.

To know more about authors claim visit:

https://brainly.com/question/30263782

#SPJ1

The answer ???????????,?,,??,,,

Answers

Answer:

The second sentence

Explanation:

Winston writes about a film in his journal. Describe the film, as well as theaudience's reaction.

Answers

Winston attends the screening of a violent war movie. He goes into considerable depth about it in his journal. One clip depicts the bombing of a refugee ship.

How did the audience react during the film 1984?

Attendees have passed out, and yelled at the actors during the London transfer previews. Some audience members were so tense after one performance that they got into a heated argument right afterwards. Charges were filed after calling the police.

"If there is hope, it resides with the proles," Winston writes in his journal. The term "proletarians," often known as "proles," refers to the working class. He muses over the current state of affairs in Oceania, where proletariat makes up 85% of the population. He considered the percentage.

Thus, Winston attends the screening of a violent war movie.

For more information about audience react during the film 1984, click here:

https://brainly.com/question/2339070

#SPJ9

1. Most public universities offer many majors in engineering. Such as
electrical, chemical, and industrial engineering.
A NO CHANGE
B
C
D
engineering such, as
engineering such. As
engineering, such as

Answers

"Engineering, for example." The comma that separates "engineering" from "such as" in this choice indicates that "such as" is giving examples of the various engineering majors that are available.

What is the most typical engineering concentration?

Mechanical engineering is arguably the most well-liked engineering field. Mechanical engineering is nearly twice as popular as the second field on this list, with between 40,000 and 60,000 undergraduate degrees issued each year. Designing, building, and improving machines is the focus of mechanical engineers.

Do employers want engineering majors?

If engineering is something you're interested in, you might be wondering if there is a demand for engineers. It will please you to know that the answer is yes. Engineers that opt to pursue careers might anticipate having good employment opportunities.

To know more about engineering visit:-

https://brainly.com/question/1446037

#SPJ1

Answer: "Engineering, for example." The comma that separates "engineering" from "such as" in this choice indicates that "such as" is giving examples of the various engineering majors that are available.

Explanation:

have a great day :3

Read pages 1-20 and create a FRJ entry (all 4 entry points) on the book "The Alchemist"

Need this asap please would appreciate the help

Answers

FRJ entry of the book "The Alchemist" is like writing the summary in entry form.

The step-by-step explanation of how to create a FRJ entry on the book “The Alchemist” is as follows:

Read the book from pages 1-20. For the first entry point, the fact, write down the main elements of the story that you read. These may include the characters, setting, plot, and major themes. For the second entry point, the reflection, think about how this book relates to the world around you or to other topics that you may have studied.

For the third entry point, the judgement, form an opinion about the book and give your thoughts on how it affected you. For the fourth entry point, the application, provide an example of how you can apply what you’ve learned from the book in your everyday life.

More on FRJ entry can be obtained from here: https://brainly.com/question/10284784

#SPJ11

Which sentence should be removed from the passage? A. Measles and chickenpox cause red patches on the body. B. Hence, people will probably get these illnesses only once in their lives. C. When a person gets one of these illnesses, tiny viruses attack the body. D. Viruses need to get into our blood before they can make us feel ill.

Answers

The sentence that should be removed from the passage is  A. Measles and chickenpox cause red patches on the body.

What does the passage state?

"Childhood Viruses Have you ever had measles, chickenpox, or mumps? These illnesses are called childhood illnesses because most of us get them when we are young. When a person gets one of these illnesses, tiny viruses attack the body. These viruses travel from person to person in the drops of water we make when we sneeze or cough, or they spread through food or water. Viruses need to get into our blood before they can make us feel ill. They do this by attaching themselves to our cells and then entering them. When they are inside the cells, they start to take over. Measles and chickenpox cause red patches on the body. However, our bodies do fight back, so these illnesses are usually not very serious. After we have been ill, our special defense cells will recognize the virus if it tries to attack our bodies again. Hence, people will probably get these illnesses only once in their lives. If any of these viruses make you feel miserable, then remember that most of us get them as well— and that we can have them only once! It is best to stay away from school if one catches such a virus and be sure to get complete rest."

Find more information about chickenpox here;

https://brainly.com/question/12279568

#SPJ1

Predict what will happen after this: will everything go according to plan? Explain your reasoning.

Answers

After a battle in Scotland, Macbeth and his friend Banquo meet three witches, who make three prophecies - Macbeth will be a thane, Macbeth will be king and Banquo's sons will be kings.

I NEED THIS ANSWERED BY TODAY!!! Why does Frankenstein pursue the creature in the final period of his life, when he has spent so much time trying to abandon and flee from the creature earlier in the novel? Include evidence from the text in your response.

Answers

In the final period of his life, Frankenstein pursues the creature with a newfound sense of purpose and determination. This is a dramatic departure from his previous attempts to flee from the creature and abandon his responsibility to it. The reason for this change lies in Frankenstein's realization that his creation is a reflection of himself and that he cannot escape his own guilt and responsibility.

Throughout the novel, Frankenstein repeatedly tries to disavow his creation and deny any connection to it. However, as he confronts the creature and witnesses the destruction it has wrought, he begins to recognize the ways in which he is responsible for its actions. He tells Walton, "I am the cause of all; I murdered her. William, Justine, and Henry — they all died by my hands" (Shelley, 187). Frankenstein acknowledges that he has been trying to escape his responsibility and that he cannot continue to do so.

Furthermore, Frankenstein realizes that the creature is a reflection of himself and that he cannot escape his own guilt and responsibility. He tells the creature, "I am thy creature: I ought to be thy Adam; but I am rather the fallen angel, whom thou drivest from joy for no misdeed" (Shelley, 142). This statement reflects Frankenstein's recognition that the creature is a product of his own ambition and that he cannot disown it without disowning himself.

In conclusion, Frankenstein pursues the creature in the final period of his life because he recognizes that he cannot escape his responsibility and that the creature is a reflection of himself. He realizes that he has been trying to disavow his creation and that he must confront it in order to face his own guilt and come to terms with his actions. The evidence from the text supports the idea that Frankenstein's pursuit of the creature is driven by his desire to take responsibility for his actions and make amends for the harm he has caused.

Answer:  He feels responsible for what the monster has done, and he feels he must destroy his creation

What is the author's main claim or argument?

Answers

Every article or the written piece of content consists of a main claim or an argument which suggests the main theme or the question raised in that written content.

What is an argument?

A claim is an arguable assertion that is not only an opinion, but rather a reality. An author's assertion should be primarily focused on demonstrating the core notion. To support your claims and arguments, use examples.

Here are a few instances of the author's claim assertions:

According to scientific evidence, soldiers who use medicinal marijuana are less likely to report having PTSD.It has been claimed by more college students and teenagers who use cellphones and social media platforms that cyberbullying is becoming worse every day.

Learn more about an argument, here:

https://brainly.com/question/29886569

#SPJ9

where does lois lowry live now

Answers

Lois lowry lives in Cambridge, Massachusetts

American author Lois Lowry is a renowned writer who is widely acclaimed for her literary works for children and young adults. A historical fiction book called "Number the Stars" is set in World War II-era Denmark. In it, a little girl named Annemarie helps a Jewish friend and her family flee the Nazis.

She has frequently stated during interviews and writings that she resides in the US city of Cambridge, Massachusetts. She continues to write and speak, and as of 2022, she owns real estate in Massachusetts and Maine. Her writings are renowned for their thought-provoking and emotionally evocative storytelling and frequently deal with themes of loss, death, and liberation. Lowry is the most prominent author in young literature, and generations of readers have continued to read and adore her stories.

Read more about Lois lowry on:

https://brainly.com/question/8124659

#SPJ4

Help pls 100 points Esperanza rising

Answers

Esperanza is characterized in the novel as a young girl with a mix of thoughts and emotions, including hope, fear, and determination.

Her background as a Mexican-American growing up in a poor neighborhood shapes her experiences and her perspectives on the world around her. Her actions reflect her strong will and resilience. Her speech also reveals her character, showing her intelligence, passion, and sense of humor. Her experiences and actions have an impact on those around her, including her friends and family, and she is portrayed as a complex and dynamic character.What are Direct and Indirect Characterization?

While direct characterization tells the reader about a character's actions, dialogue, or internal monologue, indirect characterization tells the reader about a character's actions, dialogue, or internal monologue.

The author explains the character's genuine physical and mental attributes, characteristics, and talents in direct characterization. Consider the term "telling." Indirect Characterization occurs when the author demonstrates how a character talks, thinks, acts, or reacts to other characters. Consider the term "showing."

Learn more about Esperanza:
https://brainly.com/question/29446954?
#SPJ1

what is tyler sis hazelwood

Answers

Tyler SIS is the student information system used by the Hazelwood School District in Missouri, United States. to set up communication between parents and teachers.

Several schools and districts in the United States use Tyler SIS, a student information system, to manage student data such as grades, attendance, timetables, and transcripts.

Teachers, administrators, and parents can utilize Tyler SIS's central database of student data to track students' development and make educated decisions regarding their education.

In summary, Tyler SIS is a student information system used by the Hazelwood School District in Missouri to manage student data and improve communication between teachers, administrators, and parents.

To know more about the method of data collection-

brainly.com/question/4182767

#SPJ4

write the 10000 reasons chords

Answers

"10,000 Reasons (Christian Worship)" is a popular worship song written by Matt Redman and Jonas Myrin. The song uses four chords throughout, which are G, D, Em, and C. Here are the chord progressions for each section of the song:

Verse 1:

G D/F#

Bless the Lord, O my soul

Em7 C

O my soul, worship His holy name

G D/F#

Sing like never before, O my soul

Em7 C

I'll worship Your holy name

Chorus:

G D/F#

Em7 D

G D/F#

Em7 C D G

Allow me to sing when night falls.

Verse 2:

G D/F#

Em7 C

G D/F#

Em7 C

Ten thousand motives that will make my heart glad

(Chorus)

Bridge:

G D/F#

Em7 C

G D/F#

Em7 C D G

10,000 years, and then forever more

(Chorus x2)

I hope this helps! Enjoy playing and singing "10,000 Reasons".

For such more questions on Christian Worship

https://brainly.com/question/30187107

#SPJ4

Write a paragraph about symbols in Inside Out and Back Again. Use 3 or more pieces of text evidence. Novel: Inside Out and Back Again. Due in 1 hour!! Please help!!

Answers

In "Inside Out and Back Again," symbols play an essential role in conveying the themes and emotions of the story. One symbol that appears throughout the novel is the papaya fruit, which represents both the familiar world that Ha has left behind in Vietnam and the hope of a better future.

What is a paragraph in English writing?

A paragraph is made up of several well-structured, connected sentences that all address the same subject. Paragraphs should be used to divide almost all of your work that is longer than a few sentences.

The papaya tree in Ha's old garden serves as a reminder of her former life and the bittersweet memories she has left behind. Another symbol is the color red, which represents danger and warning in Ha's culture but also the courage and resilience that she demonstrates in facing her new life in America.

Learn more about the paragraph here:

https://brainly.com/question/24460908

#SPJ1

in the "sprin and all" what connotations do many of the words in the excerpt have in common

Answers

Connotations that many of the words in the excerpt have in common is dying. Hence, option D is correct.

What is Connotation?

Connotation refers to one's personal interpretation of a word and the emotion it evokes.

The author of the excerpt from William Carlos Williams' "Spring and All" is making a reference to how depressing and lifeless everything is. When the author claims that there is a sick hospital, the expression is depressing. There has been no improvement elsewhere, the lines also state. It appears as though the world is unsteady and exposed.

Thus, option D is correct.

For more information about Connotations, click here

https://brainly.com/question/16928153

#SPJ9

The options were missing-

A. Boredom

B. Danger

O C. Spring

D. Dying

norwegian city located on an island off mainland norway

Answers

Answer:

The city center of Tromsø

Explanation:

Circular Reasoning Example :_____
A. Back to the Future (1985) is a good movie.
Why?
B. Because it's an '80s movie.
Why are '80s movies good?

Answers

Circular reasoning is a type of logical fallacy in which the conclusion of an argument is used to support the premise. It is also known as begging the question. In this example, the argument is that Back to the Future (1985) is a good movie because it is an '80s movie, and '80s movies are good.

This is circular reasoning because the premise that '80s movies are good is used to support the conclusion that Back to the Future is a good movie, but the conclusion is also used to support the premise. There is no independent evidence or support for either the premise or the conclusion.

Instead, the argument is just going in circles. A better argument would provide specific reasons or evidence for why Back to the Future is a good movie or why '80s movies are good, without relying on circular reasoning.

To learn more about Circular reasoning refer here:

https://brainly.com/question/1254657#

#SPJ11

How many sources do you need as a minimum?

3
5
7
No answer text provided.

How many graphic aids do you need minimum?

1
2
3
No answer text provided.

Answers

There should be a minimum of one source used on every page of your research paper, or three sources in total. The minimum needed for graphic aids during a presentation is one.

What are the sources of research?

Your own life experiences, print media like books, brochures, journals, magazines, and newspapers, electronic sources discovered on the Internet, and print media like magazines and newspapers can all be used as sources of research materials. They might also originate from interviews and surveys that you or another person conducts.

Primary, secondary, and tertiary materials are frequently used to categorize sources of information or proof. The originality of the content and the proximity to the source or origin are the bases for these classifications. Your research paper's bibliography should include a list of all the sources you used. The most popular style guides are APA, MLA, and Chicago, and you must strictly adhere to the guidelines they provide for producing bibliographies.

To learn more about sources, visit:

https://brainly.com/question/1307778

#SPJ1

I have suggested before, friends, that the time may be near
at hand when we shall not need to fuss with good roads nor
railway tracks, bridges, etc., at such an enormous expense.
With these machines we can bid adieu to all these things.
How does the information in the table relate to Root's
prediction in the sentences above?
O
It confirms the prediction because public road
O mileage and vehicle miles traveled began to
decrease in the 1940s.
It disproves the prediction because public road
mileage and vehicle miles traveled continued
to increase through the 1950s.
It confirms the prediction because public road
O mileage and vehicle miles traveled did not
increase dramatically in the early 1900s.
It disproves the prediction because public road
mileage and vehicle miles traveled did not
begin to increase significantly until the end of
the 1950s.

Answers

It confirms the prediction because of public roads. Thus, option 'A' is the correct option.

What is the road?

Highways are essentially what roads are; their primary purpose is to carry vehicles. While travel is still a crucial purpose, streets are generally flanked by buildings and public areas, and among these other functions, the location function is the most significant.

This should be considered while planning and designing all highways and streets. For instance, Designing Streets (2010) explains that determining a street's or road's relative relevance in terms of location and mobility functions should guide ensuing design decisions.

Learn more about the road here:

https://brainly.com/question/1995431

#SPJ9

Is there a fear of silence?

Answers

Yes, a fear of silence is known as "ailurophobia," and is defined as a fear of being alone or of being in a quiet place.

Silence anxiety (or rarely autophobia) is a type of phobia characterized by an overwhelming fear of silence, a fear of being alone, and a fear of one's own thoughts. It is often marked by feelings of insecurity and loneliness. This fear may be accompanied by physical symptoms such as chest tightness, rapid heartbeat, and shallow breathing.

People with silence anxiety may find it difficult to relax and enjoy activities that involve silence, such as meditating or being alone. They may also avoid situations in which they have to be alone, such as taking a walk alone in the park or being in a quiet room. People with this fear may try to fill the silence with noise and may avoid being in places like libraries, museums, or other places where silence is expected.

To learn more about Silence anxiety link is here

brainly.com/question/28481974

#SPJ4

how is the butterfly symbol text?

Answers

A combination of ASCII characters can be used to depict the butterfly symbol in text. One technique to make a butterfly sign is to use parenthesis, asterisks, and slashes.

To symbolise the butterfly's wings and body. Here's an example (_/)\s(* *) / \ The top of the butterfly's body and the first half of its wings are represented by the first line, the middle of the butterfly's body is represented by the second line, and the bottom half of the butterfly's wings are represented by the third line. Instead, various Unicode characters can also be used to depict a butterfly symbol in text. The butterfly emoji, for example, may be entered using an emoji keyboard or by entering its Unicode representation (U+1F98B) into a text editor that supports Unicode characters.

learn more about butterfly  here:

https://brainly.com/question/13704153

#SPJ4

What does the speaker MOST LIKELY mean by "human mind" in line 13? A. the unruly lives of the people. B. the internal conflicts of individuals
C. the intellectual and ethical views of society
D. the mental processes developed through education

Answers

Answer: D

Explanation:

when beginning a speech about a controversial issue, it is best to start with a ___

Answers

It is best to start with a statement of purpose when giving a speech on a contentious subject. The topics that spark arguments and divergent viewpoints are considered controversial.

These problems may be political, social, religious, or economic. People have varying thoughts and viewpoints on controversial matters, which frequently leads to heated discussions and debates. The most often debated topics include abortion, same-sex marriage, gun regulation, immigration, and the death penalty. These topics have the ability to stir up strong feelings and heated arguments. People often refuse to make concessions or consider all sides of an issue objectively because they have strong feelings for both sides of the argument. It's crucial to maintain civility and an open mind when debating divisive topics.

To know more about speech refer to the link below :

brainly.com/question/2179517

#SPJ4

how can speakers ensure they are being audience-centered?

Answers

Making a plan to lower your mortgage ensures that, if necessary, you will apply for credit. The many financial reporting companies that the borrowers use to judge the worth of the loan and compute your credit score are based on your statement.

Credit is the customer's ability to purchase products or services before making a payment, based on the expectation that they will have the means to pay for them in the future. n Credit is a sum received that is displayed on the right side or column of an account in an entry recording for accounts. Your financial strength contributes to the credit. With the knowledge that you may make payments later, you can obtain what you need right away, like a credit card or a car loan.Making a strategy to lower your mortgage assures that you will seek credit if required. Your statement serves as the basis for the various financial reporting agencies that the borrowers use to assess the loan's value in order to determine your credit score.

Learn more about credit from

brainly.com/question/13964348

#SPJ4

Antilles (noun): a chain of islands in the West Indies, divided into two parts, the one including Cuba, Haiti, Dominican Republic, Jamaica, and Puerto Rico (Greater Antilles), the other including a large arch of smaller islands to the SE and S (Lesser Antilles, or Caribees).
Why does the narrator believe Oscar’s “love of genre...might have been a consequence of being Antillean (who more sci-fi than us?)” (21)? What about the history or present of the Caribbean might lead the narrator to believe this?

Answers

All of the West Indies, excluding the Bahamas, are part of the Antilles, a collection of islands in the Caribbean Sea.

What is Antilles?

The Greater Antilles, which include Cuba, Hispaniola (Haiti and the Dominican Republic), Jamaica, and Puerto Rico, and the Lesser Antilles, which include all other islands, are separated into two main divisions.

Traditional usage of the term "Antilles" dates back to before European explorers arrived in the New World, when it was used to describe semi-mythical islands in the Atlantic Ocean to the west of Europe.

It was sometimes labeled as a continent, a sizable island, or an archipelago on medieval maps. The new territories were frequently referred to as "Antillas" in Spanish, and the "Sea of the Antilles" is known in a number of European languages.

Therefore, All of the West Indies, excluding the Bahamas, are part of the Antilles, a collection of islands in the Caribbean Sea.

To learn more about Antillas", refer to the link:

https://brainly.com/question/7484498

#SPJ1

What is synonym for messed with ?

Answers

A synonym for "messed with" could be "tampered with" or "interfered with." Both of these phrases convey the idea of someone or something intentionally manipulating or changing something.

"Tampered with" suggests a more deliberate and purposeful act, while "interfered with" may connote a more accidental or unintentional effect. Other possible synonyms for "messed with" might include "altered," "modified," "disturbed," or "disrupted." Depending on the context in which the phrase is used, there may be other more specific synonyms that could also apply, such as  "meddled with." Overall, any of these synonyms suggest that something has been changed or affected in some way that was not intended or desired.

To know more about synonym:

brainly.com/question/28598800

#SPJ4

Refer to these stories from the Iliad: "Agamemnon's Appeal to Achilles" and "The Arming of Patroclus."
Which incident helps develop the theme that excessive pride can lead to tragedy in "The Arming of Patroclus"?

Answers

The incident that helps develop the theme that excessive pride can lead to tragedy in "The Arming of Patroclus" is the arming of Patroclus himself. In this part of the story, Patroclus, who was acting as an ally to Achilles, becomes overly confident in his own abilities and decides to take the fight to the Trojans, wearing Achilles' armor and pretending to be Achilles himself.

What is the theme about?

This excessive pride leads to tragedy when Patroclus is killed by Hector, the Trojan prince. Patroclus' overconfidence and his desire to prove himself as a great warrior ultimately lead to his downfall, demonstrating the dangers of excessive pride and the consequences it can bring. This theme is further reinforced by Achilles' own reaction to Patroclus' death, as he is consumed by grief and rage, leading to even more violence and tragedy.

Therefore, In this way, the arming of Patroclus helps to develop the theme of excessive pride leading to tragedy, as it serves as a cautionary tale about the dangers of overconfidence and the importance of humility in the face of war and violence.

Learn more about theme from

https://brainly.com/question/11600913

#SPJ1

Other Questions
Suppose you are analyzing a newly discovered unicellular organism to determine whether it should be classified as a prokaryote or eukaryote. Which approach should you take?A. Observe whether the organism moves about using flagella or cilia.B. Analyze the metabolic reactions taking place in the cytoplasm.C. Test whether the organism can carry out photosynthesis.D. Determine whether the organism uses cytoskeletal proteins to provide structure within its cell.E. Study the type of compartmentalization of functions within the cytoplasm. why does it feel like amazon is making itself worse Determine the ratio of the volume of a paraboloid (the solid generated by rotating a parabola about the y-axis) to the volume of a cylinder with the same height and base radius. You may assume that the volume of the cylinder is V_cyl = pi r^2 h, but you must derive the volume of the paraboloid by treating it as a solid of revolution. Determine the ratio of the volume of a sphere to the volume of a cylinder with the same radius, and the height the same as the diameter of the sphere. You may assume that the volume of the cylinder is V_cyl = pi r^2 h, but you must derive the volume of the sphere by treating it as a solid revolution. (Archimedes was particularly proud of this last result and requested to have it inscribed on his grave. The Roman philosopher Cicero later discovered the tomb and had found it overgrown with vegetation. I was in Syracuse this last Summer and visited the tomb and can confirm that no such inscription exists today.) If 14 cars and 10 vans are in a parking lot what is the radio of cars to vans what level decision making process on employees develop, control, and maintain core business activities required to run the day-to-day operations? level do employees develop, control, and maintain core business activities required to run the day-to-day operations? Rafael runs 4 miles in 30 minutes. At the same rate, how many minutes would he take to run 10 miles? EXTRA POINTS AND BRAINLIEST ANSWER QUICK 2.08 how can the constitution change Amendment Idea TemplateYour Name ____________________Step 1:Describe how amendments have affected Americans' participation in government.Give specific examples from the lesson, including amendment names or numbers.Step 2:Brainstorm an idea for a new amendment to the Constitution. Answer the following questions about your new amendment idea.What will this amendment do?Whom will it benefit and how?Step 3:Identify the process that your amendment will have to follow to become part of the Constitution. Some information appears for you.Amendment Process: Two Main Steps1: ____________________ 2: RatificationMethod 1 Method 2 Two-thirds of state legislatures request a national convention Step 4:In your own words, answer the following questions about the amendment process.Why did the Founding Fathers create an amendment process for the Constitution?Why did they make the amendment process difficult to achieve? Which approach to explaining mental illness is most likely to focus on the social context of illness and treatment? a recursive function is a function that: group of answer choices calls itself, directly or indirectly. returns a double. is inside of another function. takes 3 arguments. Question 1What is power, and what is its relationship to voltage and amperage? Cyanide binds and impairs one of the molecules involved in the production of ATP. Which organelle does cyanide act upon? what is the velocity of a rock if it falls at a 3m/s Three basic team member types exist within a typical Six Sigma Project Team; ________ members provide expert information, council, or help in accessing resources when called upon by the project team leader, ________ members participate in all activities of the team and attend as many team meetings as possible, and ________ members provide expertise on an as-needed basis as subject matter expertsa. resource, regular, ad hocb. regular, resource, ad hocc. ad hoc, resource, regulard. ad hoc, regular, resource. if we change the constraint quantity to a value outside the sensitivity range for that constraint quantity, the shadow price will change. What are the most common restaurant food safety risks? Multiple Select QuestionSelect all that applySelect all the statements that correctly describe organometallic reagents.A.Organometallic reagents are good nucleophiles and strong bases.B.Organometallic reagents are ionic since they contain a bond between a metal and a nonmetal.C.Organometallic reagents are a source of electrophilic carbon.D.These reagents contain a polar carbon-metal bond. If you showed a 2-year-old that you'd hidden a toy behind the bed in a model of her bedroom, she would not be able to find the toy in her real bedroom because she lacksanswer choicesO analytical thinking.O random thinking.O critical thinking.O schematic thinking.O egocentric thinking. what did george washington believe was the proper solution to the indian problem? he piece of DNA written below was found by an undergraduate researcher while examining a novel bacteria strain. Show the undergraduate researcher what the doublestranded DNA would look like for this single strand of DNA. Make sure you show all important chemical components that describe DNA orientation.5 GGCGAATCATGCGCTGCCTTGTTTCCACTAGTAGACGCGGGACTTGGTTTCACACATGACGCGT An instructor grades on a curve (normal distribution) and your grade for each test is determined by the following where S = your score. A-grade: Su + 20 B-grade: u + OSS< + 20 C-grade: u-OSS